ID: 1177414130

View in Genome Browser
Species Human (GRCh38)
Location 21:20772350-20772372
Sequence AGACACATGCAGAATGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177414130_1177414136 3 Left 1177414130 21:20772350-20772372 CCCTGCACATTCTGCATGTGTCT No data
Right 1177414136 21:20772376-20772398 CTAACTTAAAATAAATGTTTGGG No data
1177414130_1177414137 4 Left 1177414130 21:20772350-20772372 CCCTGCACATTCTGCATGTGTCT No data
Right 1177414137 21:20772377-20772399 TAACTTAAAATAAATGTTTGGGG No data
1177414130_1177414135 2 Left 1177414130 21:20772350-20772372 CCCTGCACATTCTGCATGTGTCT No data
Right 1177414135 21:20772375-20772397 CCTAACTTAAAATAAATGTTTGG No data
1177414130_1177414141 17 Left 1177414130 21:20772350-20772372 CCCTGCACATTCTGCATGTGTCT No data
Right 1177414141 21:20772390-20772412 ATGTTTGGGGCTGGGCTTGGTGG No data
1177414130_1177414140 14 Left 1177414130 21:20772350-20772372 CCCTGCACATTCTGCATGTGTCT No data
Right 1177414140 21:20772387-20772409 TAAATGTTTGGGGCTGGGCTTGG No data
1177414130_1177414139 9 Left 1177414130 21:20772350-20772372 CCCTGCACATTCTGCATGTGTCT No data
Right 1177414139 21:20772382-20772404 TAAAATAAATGTTTGGGGCTGGG No data
1177414130_1177414138 8 Left 1177414130 21:20772350-20772372 CCCTGCACATTCTGCATGTGTCT No data
Right 1177414138 21:20772381-20772403 TTAAAATAAATGTTTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177414130 Original CRISPR AGACACATGCAGAATGTGCA GGG (reversed) Intergenic
No off target data available for this crispr