ID: 1177438229

View in Genome Browser
Species Human (GRCh38)
Location 21:21083805-21083827
Sequence ATGCTGTCATTGGGAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 12, 3: 65, 4: 411}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177438229_1177438234 10 Left 1177438229 21:21083805-21083827 CCAGTTTCTCCCAATGACAGCAT 0: 1
1: 0
2: 12
3: 65
4: 411
Right 1177438234 21:21083838-21083860 GGTAATGTAATATCATAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177438229 Original CRISPR ATGCTGTCATTGGGAGAAAC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900582616 1:3416557-3416579 CTGGTGTCACTGGGAGGAACTGG - Intronic
900905632 1:5555145-5555167 ATGCTGTCTCTTGGAGAACCCGG - Intergenic
901713351 1:11133410-11133432 ATGCTGTCATTGAGAGACAAAGG - Intronic
902189278 1:14750105-14750127 ATGCGGCCATTGTGAGAAGCTGG + Intronic
905288820 1:36907626-36907648 ATGAGGTCATCAGGAGAAACAGG + Intronic
905333296 1:37224390-37224412 ATGCAACCAATGGGAGAAACTGG + Intergenic
906305937 1:44719201-44719223 ATTCTGTGATTGGGAAAACCAGG + Intronic
907737661 1:57130591-57130613 ATCCTGTCATTTGGAGAACATGG + Intronic
909299571 1:73995081-73995103 ATACTGCCATTGAGAGACACAGG + Intergenic
912377426 1:109222269-109222291 ATGTTATCATTGGGGAAAACGGG - Intronic
913290832 1:117270095-117270117 ATCCTGTCTTTGGGACAGACTGG + Intergenic
913457469 1:119048520-119048542 ATGTTGCCATTGAGGGAAACTGG - Intronic
913597511 1:120393142-120393164 ATGCTGCCATAAGGAGAAAGGGG - Intergenic
914089819 1:144486172-144486194 ATGCTGCCATAAGGAGAAAGGGG + Intergenic
914308791 1:146448044-146448066 ATGCTGCCATAAGGAGAAAGGGG - Intergenic
914593317 1:149125087-149125109 ATGCTGCCATAAGGAGAAAGGGG + Intergenic
917704207 1:177615244-177615266 ATCCTGTCATTTGTAGCAACAGG + Intergenic
917732312 1:177887334-177887356 ATTCTGTCATTTGAAGCAACAGG - Intergenic
917759239 1:178137371-178137393 ATGCAGTAATTGGGAGAAAGAGG - Intronic
917923942 1:179773460-179773482 ATGTTACCATTGGGGGAAACTGG + Intronic
918756955 1:188350192-188350214 ATGTTGACATTGACAGAAACTGG - Intergenic
919162740 1:193853034-193853056 ATTGTATCATTAGGAGAAACTGG - Intergenic
919208767 1:194453060-194453082 GTTTTGTCATTGGCAGAAACTGG - Intergenic
920352319 1:205345359-205345381 ATGTTGCCATTGGGAGAAACTGG - Intronic
921128728 1:212200719-212200741 ATTCTGTGATTGGTAGAAAGAGG + Intergenic
921399158 1:214701615-214701637 ATGTTATCATTGGCGGAAACCGG - Intergenic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924310339 1:242734821-242734843 ATGTTATCATTGAGGGAAACTGG + Intergenic
924662111 1:246030251-246030273 ATCCTGTCATTTGCAGCAACAGG + Intronic
1063494651 10:6495655-6495677 ATGCTGTCATTGGAAGAATGCGG + Intronic
1065227568 10:23560371-23560393 ATGTTATCATTGGGTGAAACTGG - Intergenic
1067100695 10:43332336-43332358 ATGTTATCATTGGGGGAAACTGG + Intergenic
1067241940 10:44504899-44504921 ATGTTACCATTGGGGGAAACTGG + Intergenic
1068833780 10:61528700-61528722 ATGCTATCATTGGGGGGAAATGG + Intergenic
1070082195 10:73199890-73199912 ATGGTGTCATCGAGAGCAACTGG + Intronic
1070150809 10:73803710-73803732 GTGCTGGCATTGGAAGGAACAGG + Exonic
1070857543 10:79619339-79619361 TTGCAGTCATTTGGAGAAAAAGG + Intergenic
1071241912 10:83716396-83716418 ATGTTATTATTGGTAGAAACTGG + Intergenic
1071571130 10:86697938-86697960 ATGCTACCATTGGGAGAAGCTGG - Intronic
1072378665 10:94842858-94842880 AACGTGTCATTGGCAGAAACCGG + Exonic
1072540292 10:96393411-96393433 AGGCTGTCATCAGGAGAAAATGG - Intronic
1072599529 10:96912328-96912350 ATGCTAACATTTGGAGAATCTGG - Intronic
1072696092 10:97603939-97603961 ATGTTGCCATTGGGGAAAACTGG - Intronic
1072976195 10:100060946-100060968 ATCCTGTCATTTGCAAAAACAGG + Intronic
1073283781 10:102374781-102374803 ATGTTACCATTGGGATAAACTGG + Intronic
1073376186 10:103036998-103037020 ATGTTACCATTGGGGGAAACTGG + Intronic
1073813435 10:107177352-107177374 ATGTTACCATTGGGGGAAACTGG - Intergenic
1074073307 10:110096079-110096101 GTGTTGCCATTGGGAGAAACTGG + Intronic
1074181247 10:111066435-111066457 ATCCTGTCATTTGCAGCAACAGG + Intergenic
1074800017 10:116990576-116990598 AGGCTGTCGTTGGAAGAAACTGG + Intronic
1075095947 10:119471100-119471122 ATGCAAGCATTGGGGGAAACTGG + Intergenic
1075290324 10:121224309-121224331 ATGCTACCTTTAGGAGAAACCGG + Intergenic
1076517911 10:131059670-131059692 ATGTTACCATTGAGAGAAACAGG + Intergenic
1076666783 10:132097655-132097677 ATGTTCTCATTGGGGGAAATAGG + Intergenic
1078038241 11:7831640-7831662 ATGCGTTCATTGGAAGAAATTGG - Intergenic
1078072181 11:8122100-8122122 ATGTTGCCTTTGGGAGAAACTGG - Intronic
1078792027 11:14553230-14553252 ATGTTACCATTGGGGGAAACAGG - Intronic
1078949685 11:16116581-16116603 ATGTTATCATTTGGGGAAACTGG - Intronic
1079142650 11:17822911-17822933 ATGTTGACAATGGGGGAAACTGG - Intronic
1079523288 11:21354409-21354431 TTTCTCTCATTGGGTGAAACTGG + Intronic
1080010295 11:27452325-27452347 ATGTTGCCATTGGGAAAAGCTGG - Intronic
1080022620 11:27578975-27578997 AAGCTATCATTGGGTGAAATTGG - Intergenic
1080636284 11:34126583-34126605 ATGCTGGCATGGGGGTAAACTGG - Intronic
1080957854 11:37121913-37121935 ATCCTGCCTTTGGGAGAATCTGG + Intergenic
1081443994 11:43111896-43111918 ATGTTATCATTGGGGGAAACTGG + Intergenic
1084267792 11:68013863-68013885 CTGCTCTGATTGGGAGAAGCTGG - Intronic
1085256817 11:75178921-75178943 ATCCTGTCATTGTGAAAACCTGG - Intronic
1086470104 11:87099400-87099422 ATGCTACCATTGGGGGAAAATGG - Intronic
1087206228 11:95398356-95398378 ATGTTCTCATTGAGATAAACTGG + Intergenic
1087320112 11:96647641-96647663 ATGCTTTCATTGAGAAATACGGG - Intergenic
1087448067 11:98280652-98280674 ATGTTACCATTGGGGGAAACAGG - Intergenic
1087744481 11:101927415-101927437 ATGTTATCATTGGGGGAAACTGG - Intronic
1088966842 11:114731865-114731887 ATGTTACCATTGGGGGAAACTGG + Intergenic
1089087520 11:115835640-115835662 ATGTTTTCATGGGGAGACACTGG + Intergenic
1089122976 11:116153283-116153305 ATATTATCATTGGGGGAAACTGG + Intergenic
1089571283 11:119412213-119412235 ATGTTGCCATTGGGGGAAACTGG - Intergenic
1090161869 11:124503774-124503796 ATGTTACCATTGGGAGAAACTGG + Intergenic
1090334574 11:125954092-125954114 ATGGTGACATTGGGAGGAGCTGG - Intergenic
1090657964 11:128860201-128860223 ATGCAGTGCTTGGGAGAATCCGG + Intronic
1090726559 11:129532364-129532386 ATGCTGTCACCAGGAGAAAGAGG - Intergenic
1090787623 11:130064158-130064180 ATGATGCCATTGGCAGAAATAGG - Intergenic
1091149049 11:133309679-133309701 ATGTTGACATGAGGAGAAACTGG + Intronic
1091926086 12:4350881-4350903 GTGCTGTCATTGGGATCAAATGG + Intronic
1091968732 12:4767466-4767488 ATGCTGTCTTTGTGAGGAAGAGG + Intronic
1092348708 12:7738381-7738403 GTGCTGACAGTGGAAGAAACTGG - Intronic
1092593102 12:9968932-9968954 ATCCTGTCATTTGCAGAAACAGG + Intronic
1092699846 12:11216087-11216109 ATACTGTCTCTGGGAGAAAAAGG + Intergenic
1092909768 12:13136450-13136472 ATGCTAAAATTGGGAGAAACTGG + Intronic
1094286327 12:28798548-28798570 ATGCTTTCATTAGGAAAACCAGG + Intergenic
1095207389 12:39454202-39454224 ATGATATCATTAGCAGAAACAGG + Intergenic
1095922911 12:47548837-47548859 ATGTTAACATTAGGAGAAACTGG + Intergenic
1095952629 12:47790078-47790100 ATGCTGGGATTGGGGGACACAGG - Intronic
1096664393 12:53153330-53153352 AAGGTGTCATTGAGAGTAACTGG + Intergenic
1097172799 12:57127193-57127215 AGTCTGTCCTTGGCAGAAACAGG - Intronic
1097641667 12:62190948-62190970 TTGCTGTTATTAGGAGAAATGGG + Intronic
1097704996 12:62859135-62859157 ATGCTATCCCTGGAAGAAACAGG + Intronic
1098556816 12:71828182-71828204 ATGCTATCACTGGGAAAAACTGG - Intergenic
1098594080 12:72251036-72251058 ATGTTAGCATTGGGAGAAACTGG - Intronic
1098996934 12:77131218-77131240 ATGTTGCCATTAGAAGAAACTGG - Intergenic
1099952351 12:89318000-89318022 ATGCTTTCATTGGGAGACTGAGG - Intergenic
1100229582 12:92593595-92593617 ATGCTGTGATGGGGAATAACAGG + Intergenic
1100443236 12:94637249-94637271 ATGCAATCATTGGGAGAAGCTGG + Intronic
1101549673 12:105750332-105750354 CTGCTATCATTGGGACACACAGG + Intergenic
1101615553 12:106333204-106333226 ATGCTGTCCTTGGGGGCAGCTGG + Intronic
1102531777 12:113551913-113551935 ATGCTGTTATGGAAAGAAACAGG - Intergenic
1103680567 12:122690358-122690380 ATGCTATTATTGGGAGCCACAGG - Intergenic
1104252261 12:127106506-127106528 ATGCTGTGAATAGGAGATACAGG + Intergenic
1104382705 12:128321728-128321750 ATGTCATTATTGGGAGAAACTGG + Intronic
1104588475 12:130066000-130066022 ATGCTGTCCTTGTGACAGACAGG + Intergenic
1105047775 12:133020199-133020221 ATCCTGTCATTTGCAGCAACTGG + Exonic
1105048033 12:133022561-133022583 ATGTTAGCATTGGGGGAAACTGG + Exonic
1106987966 13:35378091-35378113 TTACTGTCTTGGGGAGAAACAGG + Intronic
1107134956 13:36933660-36933682 ATGCTACCACTGGGGGAAACTGG - Intergenic
1107368455 13:39713086-39713108 ATGATGTGACTGGGAGAAAGAGG - Intronic
1108802592 13:54117359-54117381 ATGGTGTAATTGGGGGAAAGGGG + Intergenic
1110243388 13:73293705-73293727 ATGATGTGATTGGGAAAAAATGG - Intergenic
1111809945 13:93087874-93087896 ATGCTGAGATTGGGAAACACAGG + Intergenic
1112648719 13:101367088-101367110 ATTCTGTCATTTGGAATAACAGG - Intronic
1112905210 13:104409526-104409548 ATGCTATCATTTGGAGAAACTGG + Intergenic
1113356661 13:109587650-109587672 TTGCTGTCATTGCCAGAAATAGG + Intergenic
1115137082 14:30123298-30123320 CTGCTGTCATTGGGAGGATGGGG - Intronic
1115659380 14:35476884-35476906 ATGTTACTATTGGGAGAAACTGG - Intergenic
1115863884 14:37720955-37720977 ATGTTGTCTTTGGGCTAAACTGG + Intronic
1115967918 14:38912667-38912689 ATGCGGTCATTTGGAAAAAGAGG - Intergenic
1116969123 14:51046438-51046460 ATGCTACCACTGGGAGAAACTGG + Intronic
1117171175 14:53099218-53099240 ATGCTAACATTAGGAGAAGCTGG - Intronic
1117333114 14:54733998-54734020 ATACTGTCATGGGCAGAAAGAGG - Intronic
1117924555 14:60764842-60764864 AAGCTGTAATTAGGAGAAAAAGG + Intronic
1118300264 14:64608877-64608899 ATGCTACCATTGGGAGAAACTGG - Intergenic
1118680075 14:68231814-68231836 ATGATGTTAATGAGAGAAACAGG + Intronic
1119170870 14:72535457-72535479 ATGTTGCCATTGGGGCAAACTGG - Intronic
1119775677 14:77246960-77246982 GTGCTTCCATTGGGGGAAACTGG - Intronic
1121601929 14:95211755-95211777 ATGCTGTCACTGGAGGAAGCTGG - Intronic
1121646606 14:95522030-95522052 ATGCTGCCATCGGTGGAAACTGG - Intergenic
1121710594 14:96036084-96036106 ATGTTATCATTGGGAGAAACTGG + Intergenic
1122250130 14:100432557-100432579 ATGTTAACATTTGGAGAAACTGG - Intronic
1124918677 15:34002066-34002088 ATGTTATCATTGGGGTAAACTGG - Intronic
1125124635 15:36205912-36205934 ATATTATCATTAGGAGAAACTGG + Intergenic
1125460920 15:39905957-39905979 ATGCTACCACTGGGGGAAACTGG + Intronic
1126046644 15:44647922-44647944 AAGCTGTCATTTAAAGAAACTGG + Intronic
1126828427 15:52574455-52574477 ATTCTGTCATTTGCAGCAACTGG - Intergenic
1127047293 15:55040368-55040390 ATCTTGTCATTTGCAGAAACAGG - Intergenic
1128411928 15:67408122-67408144 ATGCTGTTATTGCGAAAAACTGG - Intronic
1128981358 15:72189456-72189478 ATGTTACCATTGGGGGAAACTGG + Intronic
1130142610 15:81241706-81241728 ATGTTACCATTGGGGGAAACTGG - Intronic
1131588076 15:93717632-93717654 AGGTTGTCATGGGGAGAAACCGG - Intergenic
1131705414 15:94990321-94990343 ATGTTACCATTGGGGGAAACTGG + Intergenic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1131952568 15:97696595-97696617 ATGTTATCAGTGAGAGAAACTGG - Intergenic
1132159513 15:99525668-99525690 ATGCTGCCATTTGGAGGAACAGG - Intergenic
1132411607 15:101582672-101582694 ATGCTACCACTGGGGGAAACTGG - Intergenic
1132658483 16:1051277-1051299 AGGCCGTCAGTGGGAGACACAGG + Intergenic
1133094637 16:3434295-3434317 CTGCCCTCAGTGGGAGAAACTGG - Exonic
1133461060 16:5986433-5986455 ATGTTGACACTGGGAGAAACTGG - Intergenic
1133487563 16:6234924-6234946 ATGTTTCCATTGGGGGAAACTGG + Intronic
1134345375 16:13386219-13386241 ATGTTATCATTAGGAGAAACTGG + Intergenic
1134392139 16:13829899-13829921 ATGGTGTGATGGGGAGAAATCGG + Intergenic
1134448530 16:14348742-14348764 ATGCTGGCATTTGGAGAAGCTGG - Intergenic
1137468446 16:48732666-48732688 ATGCCATCATTGGGAGAAACTGG - Intergenic
1137488194 16:48909202-48909224 ATAGAGTCATTGGGAGCAACGGG - Intergenic
1137497520 16:48982183-48982205 ATGTTTTCATTGGGAGAAACTGG - Intergenic
1137650764 16:50118256-50118278 ATGTTGTCATTTGTGGAAACAGG + Intergenic
1138213972 16:55186808-55186830 ACACTGTCAGTGGGAGATACAGG + Intergenic
1138639465 16:58372006-58372028 ATGTTACCATTGGGGGAAACTGG - Intronic
1140246505 16:73254586-73254608 ATGCTGCCATTGGAGGAAGCTGG - Intergenic
1140426545 16:74866105-74866127 ATGTTACCATTGGGGGAAACTGG - Intergenic
1140696056 16:77535463-77535485 TTGCTGACCTTGGGAGAGACAGG + Intergenic
1141578078 16:84977865-84977887 ATGCTGTTATTGGATGAAAGGGG - Intronic
1141786519 16:86204359-86204381 ATGTTACCAGTGGGAGAAACTGG - Intergenic
1144076535 17:11724485-11724507 ATCCTGTCATTTGCAGCAACAGG - Intronic
1147551901 17:41449116-41449138 GTGCTGTCATTTGGAGATCCTGG - Intergenic
1147630749 17:41929749-41929771 ATGTTACCATTGGGAGAAACTGG - Intronic
1148204977 17:45774542-45774564 ATGCTGTTATGGGGTGAAAGAGG - Intergenic
1148526990 17:48348526-48348548 AAGTTGACATTGGGGGAAACTGG - Intronic
1149809162 17:59650711-59650733 ATGTAGCCATTGGGAGAAACTGG - Intronic
1150137078 17:62701970-62701992 ATGCTGTCTTTGGGGGAAGCTGG - Intronic
1150628075 17:66856408-66856430 ATGTTGCCATTGGGTGAAACTGG - Intronic
1150839590 17:68595521-68595543 AGGCTCTAATTGGGAGAAATGGG + Intronic
1151276769 17:73040575-73040597 ATGTTCACATTGGGGGAAACTGG + Intronic
1151992385 17:77584358-77584380 ATGCTGACATTAGGAGAAGCTGG - Intergenic
1152677913 17:81651144-81651166 GTGATGTCTGTGGGAGAAACGGG + Exonic
1153966963 18:10190956-10190978 ATGCTTTCTATGGGAGAAAGTGG + Intergenic
1153982286 18:10320720-10320742 ATGCAGTTATGGGGAGAAATGGG - Intergenic
1154505547 18:15037174-15037196 ATGCTGGCTGTAGGAGAAACAGG - Intergenic
1155042580 18:22077174-22077196 ATCCTGTCATTTGCAGCAACAGG - Intergenic
1155527620 18:26733249-26733271 ATGCTGTCATTGGATGACATTGG + Intergenic
1155546531 18:26921568-26921590 TTGCTGTGATTGGAAGAAAATGG - Intronic
1156147226 18:34198642-34198664 ATGCTGTCATTGCTAGGTACAGG + Intronic
1157524516 18:48370551-48370573 ATATTGCCATTGGGGGAAACTGG + Intronic
1157994002 18:52533137-52533159 ATGATACCATTGGGGGAAACAGG - Intronic
1157998313 18:52586703-52586725 ATTCTGGCTATGGGAGAAACAGG + Intronic
1158909267 18:62043236-62043258 ACCCTGTCCTTGGGAGAACCTGG - Intergenic
1159075522 18:63677427-63677449 ATATTGTTATTGGGGGAAACTGG - Intronic
1159293363 18:66450618-66450640 ATCCTGCCTATGGGAGAAACAGG + Intergenic
1160241613 18:77128667-77128689 ATGTTATTGTTGGGAGAAACTGG + Intronic
1162001724 19:7748798-7748820 ATGTTACCATTAGGAGAAACTGG - Intergenic
1162277691 19:9670513-9670535 ATTCTGTCATTTGCAGCAACTGG + Intronic
1162397020 19:10423111-10423133 CTGCTGGCATATGGAGAAACTGG + Intronic
1162827850 19:13264702-13264724 ATGCTGTCGGAGGGAGCAACAGG - Intronic
1165915135 19:39253957-39253979 ATGTTACCATTGGGGGAAACTGG + Intergenic
1166650046 19:44566348-44566370 ATGTATTCATTGGGGGAAACTGG + Intergenic
1167681497 19:50925100-50925122 ATGTTACCATTGGGAGAATCTGG - Intergenic
925403040 2:3589315-3589337 ATGCTGGCATGAGGGGAAACAGG - Intergenic
925460924 2:4061866-4061888 ATCCTGGCTATGGGAGAAACAGG - Intergenic
927145052 2:20158812-20158834 ATGTTACCATTGGGGGAAACCGG - Intergenic
927795729 2:26046979-26047001 CTGCTACCATTGGAAGAAACTGG - Intronic
928549283 2:32356155-32356177 ATGCAACCATTGGGGGAAACTGG + Intergenic
929090608 2:38213563-38213585 ATGTTACCATTGGGAGAAACTGG + Intergenic
930291787 2:49503236-49503258 ATGTTATCATTGAGAGAAGCAGG - Intergenic
930327613 2:49940022-49940044 AAGCTGTTAATGGAAGAAACAGG - Intronic
931513899 2:63030308-63030330 ATATTGTCATTGGGAGAATGGGG - Intronic
931534229 2:63254598-63254620 ATATTATCATTGGAAGAAACTGG - Intronic
932791605 2:74658358-74658380 ATGCTGTGAAAGGAAGAAACAGG - Intronic
932851735 2:75194289-75194311 ATGCTGACATTGGAAAAGACAGG + Intronic
932866867 2:75352715-75352737 ATGCTGTCAGTGGTAGATACAGG - Intergenic
932934537 2:76086705-76086727 ATGGTGTCCTTGGCAGACACAGG + Intergenic
933679241 2:85084482-85084504 ATGTTACCATTGGCAGAAACTGG + Intergenic
933884678 2:86707121-86707143 ATGTTATCATTGGGGGAAACTGG - Intronic
934071923 2:88392177-88392199 ATTCTGTGATTATGAGAAACAGG + Intergenic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
934863587 2:97786154-97786176 GTGTTACCATTGGGAGAAACTGG + Intronic
935251048 2:101261191-101261213 AGGCAGCCACTGGGAGAAACAGG - Intronic
936007575 2:108904941-108904963 ATGTTATCGTTAGGAGAAACTGG + Intronic
936273035 2:111066520-111066542 ATGTTACCATTGGGCGAAACTGG + Intronic
937130362 2:119506991-119507013 ATGTTACCATTGGGAGAAACTGG + Intronic
937618301 2:123953771-123953793 ATGTTACCATTGGGAGATACTGG + Intergenic
937629288 2:124081838-124081860 ATGTTGACACTGGGAGAAACTGG - Intronic
937709508 2:124963002-124963024 ATGTTACTATTGGGAGAAACTGG + Intergenic
938004955 2:127781546-127781568 TTGTTATCATTGGGAGAAACTGG + Intronic
938160130 2:128978463-128978485 GTGCTGTGAATGGGAGGAACAGG + Intergenic
938227872 2:129632678-129632700 ATGTTACCATTGGAAGAAACTGG - Intergenic
938749365 2:134314170-134314192 AATCTGTGACTGGGAGAAACTGG - Intronic
939133436 2:138265643-138265665 ATCCTGTCATTTGCAGCAACAGG + Intergenic
939857950 2:147383092-147383114 ATGTTATCACTGTGAGAAACTGG - Intergenic
940189970 2:151030692-151030714 AGGGTTTCATTGGGTGAAACGGG + Intronic
940724962 2:157326579-157326601 AATCTGCCCTTGGGAGAAACAGG + Intronic
940799431 2:158117097-158117119 ATTCTGTAATTTGCAGAAACTGG - Intronic
940861864 2:158779018-158779040 ATGTTACCATTGGGTGAAACTGG + Intergenic
942284665 2:174403830-174403852 ATGTTACCATTGGGGGAAACTGG + Intronic
943068424 2:183113489-183113511 ATGTAATCATTGGGAGAAACTGG + Intergenic
943194384 2:184725587-184725609 ATGCAGCCAGTGGGGGAAACTGG - Intronic
943588129 2:189764435-189764457 ATGCTGTTATTATGTGAAACAGG + Intergenic
945058338 2:205887449-205887471 ATGCTGGCATTGGAAGATCCTGG - Intergenic
945186818 2:207147750-207147772 ATGGCGCCATTGGGAGAAGCTGG + Intronic
945882639 2:215342426-215342448 ATGCTAGCATTAGGAGAAATAGG - Intronic
945966151 2:216189234-216189256 AGGCTGTGATTTGGGGAAACAGG + Intronic
947366513 2:229401733-229401755 ATGTTATCATTGGAGGAAACTGG + Intronic
947550932 2:231046175-231046197 ATGTTACCATTGGGGGAAACTGG - Intronic
947854976 2:233317385-233317407 ATGGAACCATTGGGAGAAACTGG + Intronic
947954074 2:234172210-234172232 ATGATGGCTCTGGGAGAAACTGG + Intergenic
948224355 2:236297601-236297623 ATGTTACCATTGGGGGAAACTGG + Intergenic
948487683 2:238291198-238291220 ATGCTGCCAGTGGGAGGAGCTGG + Intergenic
949020381 2:241737882-241737904 GTGCTGTCATTGGGAAGATCTGG + Intronic
1168751699 20:286657-286679 ATGTTGCCACTGGGAGAAACTGG - Intronic
1168817259 20:747488-747510 ATGCTATCATTGAGAGAAGTTGG - Intergenic
1169246461 20:4028937-4028959 ATGTTACCATTGGGGGAAACTGG - Intergenic
1172965752 20:38833495-38833517 ATGCTACCACTGGGATAAACTGG + Intronic
1173045857 20:39511100-39511122 ATGTTATCATTGGGGGAAACTGG - Intergenic
1173628193 20:44489422-44489444 ATGCTGTCACAGGCAGGAACAGG - Exonic
1173686775 20:44929473-44929495 ATGTTCACATTGGGGGAAACTGG + Intronic
1173878511 20:46392660-46392682 ATGCTGTGTTTGGGAAAAGCAGG - Intronic
1174976001 20:55335039-55335061 ATGCTATCATTTGGGGAAGCTGG - Intergenic
1175402767 20:58709981-58710003 ATGCTGACATTGGCAGAATCTGG + Intronic
1175656747 20:60777424-60777446 ATGTTACCATTGGGAGAAACTGG - Intergenic
1176179994 20:63745309-63745331 ACCCTGTCATTGGTAGAACCGGG + Exonic
1176792313 21:13331944-13331966 ATGCTGGCTGTAGGAGAAACAGG + Intergenic
1176956294 21:15108036-15108058 ATGCCACCATTTGGAGAAACTGG - Intergenic
1177438229 21:21083805-21083827 ATGCTGTCATTGGGAGAAACTGG - Intronic
1177561291 21:22757643-22757665 CTGCTGTAATTGGGACAAATAGG + Intergenic
1177991710 21:28042810-28042832 ATGCTGGCTGTAGGAGAAACAGG + Intergenic
1178116174 21:29419479-29419501 ATGTTACCATTGGGAGAAAATGG - Intronic
1178369220 21:32013229-32013251 ATGCTAACAATGGGAGAAACTGG - Intronic
1178522317 21:33296645-33296667 ATGTTTTAATTGTGAGAAACAGG + Exonic
1178628788 21:34241332-34241354 GTGCTGTTGTTGGGAGAAGCTGG + Intergenic
1180164370 21:46014999-46015021 ATGCTAACGTTGGGGGAAACTGG - Intergenic
1180906766 22:19418829-19418851 ATGTTAACATTGGGAGAAACTGG + Intronic
1182020140 22:27074871-27074893 CTGGAGTCATAGGGAGAAACTGG + Intergenic
1182151529 22:28030473-28030495 ATGCTGTCATCTGGAGACAACGG - Intronic
949159915 3:869044-869066 ATATTGTCATTGGGGGAAGCTGG - Intergenic
949469975 3:4384334-4384356 ATGTTGCCATTGGGGAAAACTGG - Intronic
950101655 3:10360664-10360686 GTGATGACATTGGGGGAAACTGG - Intronic
950486214 3:13275476-13275498 GTGCTGTCATTGGTTGTAACAGG - Intergenic
951878164 3:27451834-27451856 ATGTTAACATTAGGAGAAACTGG + Intronic
951944441 3:28118937-28118959 ATACTGCTATTGGGAGAAGCTGG + Intergenic
952105343 3:30064199-30064221 ATACTTTCATTGGTAGAACCAGG - Intergenic
952831185 3:37566439-37566461 ATGTTATCATTGGGAAAAGCCGG - Intronic
954965651 3:54608250-54608272 ATGTTATCATTGGGGGAAGCTGG + Intronic
956039724 3:65133178-65133200 ATGTTCTATTTGGGAGAAACAGG - Intergenic
956171303 3:66435725-66435747 ATGTCACCATTGGGAGAAACTGG + Intronic
956377754 3:68634074-68634096 ATGCTGCCATTGTCAGACACTGG + Intergenic
956680721 3:71777119-71777141 ATGTCACCATTGGGAGAAACTGG + Intronic
957370359 3:79286346-79286368 ATGGTGTTATTGGGAGATATGGG - Intronic
957746901 3:84356133-84356155 ATACTTTCATCGGGAGAAGCTGG + Intergenic
957803883 3:85121332-85121354 TTGCTGTCTGTGGGAAAAACAGG + Intronic
958023460 3:88023881-88023903 ATCCTGTCATTTGCAGCAACTGG + Intergenic
958411348 3:93820370-93820392 ATGCTGTGATTGGGAGGGAGGGG - Intergenic
958807968 3:98834606-98834628 ATCCTGTCATTTGCAGCAACAGG - Intronic
958958764 3:100489299-100489321 ATGTTACCATTGGGGGAAACTGG - Intergenic
959575701 3:107930970-107930992 ATGCTGTGAGTGGGTAAAACAGG + Intergenic
960066754 3:113382542-113382564 ATTTTGTAAGTGGGAGAAACAGG + Intronic
960438456 3:117656591-117656613 ATGATGACATTAAGAGAAACTGG - Intergenic
960544661 3:118900115-118900137 ATGTTACCATTGGGAGAAATAGG + Intergenic
960948778 3:122984903-122984925 AAGAAGTCTTTGGGAGAAACAGG - Intronic
961756621 3:129131218-129131240 CTGCTGGCACTTGGAGAAACTGG + Intronic
962876685 3:139540561-139540583 GTGCTGCCATTAGGTGAAACGGG - Intergenic
964106990 3:153050095-153050117 ATGAAGTCATTTTGAGAAACTGG + Intergenic
965962769 3:174448202-174448224 ATGTAGCCAGTGGGAGAAACTGG - Intronic
966044140 3:175529486-175529508 ATCCTGGCTGTGGGAGAAACAGG + Intronic
966817158 3:183898657-183898679 ATTCTGTCCTTGGCAGAAATTGG - Intergenic
968404487 4:327980-328002 TTGCTGTCAGTTGGAGAAAAGGG - Intergenic
968770567 4:2503327-2503349 CTGCAGTCATTGGGAGACCCGGG + Intronic
969290124 4:6233474-6233496 ATGCACTCATGGAGAGAAACGGG - Intergenic
970505473 4:16724974-16724996 ACCATGTCATTGGTAGAAACAGG + Intronic
970536452 4:17035024-17035046 ATGCTGTTATTGGGGGAAGCTGG - Intergenic
970750845 4:19358609-19358631 ATGTTACCATTGGGGGAAACTGG + Intergenic
971221143 4:24706986-24707008 ATGTAGCCATTGGGGGAAACTGG - Intergenic
971855534 4:32038690-32038712 ATGCTCTCAGTGGGATAAAAAGG + Intergenic
972580484 4:40391325-40391347 CACCTGTCACTGGGAGAAACTGG - Intergenic
973836860 4:54818509-54818531 AAGCTGACAGTGGGAGAAAGTGG + Intergenic
973874304 4:55200637-55200659 ATATTACCATTGGGAGAAACTGG + Intergenic
974610123 4:64206114-64206136 TGGCTCTCATTGGGAGGAACGGG + Intergenic
974652014 4:64766458-64766480 ATTCTGTCCTTGGGAGAAAATGG + Intergenic
975225699 4:71869351-71869373 ATGTTACCATTGGGAAAAACTGG - Intergenic
976025157 4:80678824-80678846 ATGTTGTCAATGGAGGAAACTGG - Intronic
977350066 4:95872892-95872914 ATGTTGTAATTGTGGGAAACAGG + Intergenic
977421057 4:96800178-96800200 ATGTTATCATTGGAGGAAACTGG + Intergenic
977916923 4:102604385-102604407 ATGTTACCATTGGGGGAAACTGG - Intronic
977973472 4:103237684-103237706 ATGTTATCATTGGGAGAAACTGG + Intergenic
977986793 4:103391934-103391956 ATGTTATCATTGGGAGAAACTGG - Intergenic
979325220 4:119371311-119371333 ATGTTGTCATTTTGAAAAACAGG - Intergenic
979448638 4:120842737-120842759 AAGCTGTCATGGGGGGAAAGTGG - Intronic
979780137 4:124641572-124641594 ATGTTATCATTGGAAGAATCCGG + Intergenic
980463118 4:133144084-133144106 ATGCTGTCAAAAGCAGAAACGGG + Intergenic
980862572 4:138517322-138517344 ATGCAGTCATTCAGAGAACCAGG - Intergenic
982677816 4:158396209-158396231 ATTCTGTCACTGTGAGAAACTGG - Intronic
982974103 4:162031199-162031221 TTGCTGTCATTAGCAGAAATAGG + Intronic
983243124 4:165256329-165256351 ATGTTGTCATTTTGAAAAACGGG - Intronic
983645193 4:169982531-169982553 ATGTTATCACTGAGAGAAACTGG + Intergenic
983844571 4:172501194-172501216 ATGTTACCATTTGGAGAAACTGG + Intronic
984819316 4:183866316-183866338 AGGCTGCCAGTGAGAGAAACCGG - Intronic
985429754 4:189867852-189867874 ATGCTCTCATGGAGATAAACTGG + Intergenic
986004936 5:3659741-3659763 ATGTTATCATTGAGGGAAACTGG - Intergenic
986122359 5:4853263-4853285 ATGTCCTTATTGGGAGAAACTGG - Intergenic
986386540 5:7239714-7239736 ATGTTCCCATTGGGAGAAGCTGG - Intergenic
986952596 5:13108575-13108597 ATGCTGTCATGGAGAGAATTTGG + Intergenic
987987821 5:25171817-25171839 ATGTTACCATTTGGAGAAACCGG + Intergenic
988661296 5:33272146-33272168 ATGCTATCATTGGGGGAAGTTGG + Intergenic
989251376 5:39319621-39319643 ATTCTGGCACTGGGTGAAACTGG - Intronic
989751737 5:44903033-44903055 ACACTACCATTGGGAGAAACTGG + Intergenic
991537126 5:67681965-67681987 ATTCTGTCATTTGCAGCAACAGG - Intergenic
991622342 5:68557968-68557990 ATGTTGCCATTGGGAAACACTGG - Intergenic
991655130 5:68896326-68896348 AAAATGTCATTGGGAGAAAAAGG - Intergenic
992113281 5:73516056-73516078 AGCCTGTCAGTGGTAGAAACAGG + Intergenic
992892220 5:81213953-81213975 ATGCTGCTGTTGGGGGAAACTGG - Intronic
992981796 5:82182848-82182870 ATGTTACCATTGGGGGAAACTGG + Intronic
994910338 5:105897290-105897312 ATGCTGTCTTTGGCAGACAAAGG + Intergenic
995448945 5:112279215-112279237 ATGCTGACATTCATAGAAACAGG + Intronic
996437199 5:123447790-123447812 TTGCTATCATTGGGAGAAGCTGG - Intergenic
996811516 5:127520894-127520916 ATGCTGTTACTGAGAGAAGCTGG + Intronic
996869493 5:128172279-128172301 ATGTTATCATTGGGGGAAACTGG - Intronic
997034558 5:130173376-130173398 ATGTTATCAGTGAGAGAAACTGG - Intronic
997275861 5:132588551-132588573 ATGTTATCATTGGGAGAAACTGG + Intronic
997476994 5:134148711-134148733 ATGCAGTCTTTGGGAGGAAGGGG - Intronic
997677781 5:135726319-135726341 ATGTTACCATTGGAAGAAACTGG - Intergenic
998835442 5:146198554-146198576 ATGCTGCCATTGGAGGAAACTGG - Intergenic
999674440 5:153984772-153984794 CTGTTATCATTGGGGGAAACTGG - Intergenic
1000614367 5:163411325-163411347 ATGATGTTATTTGGAGAAAAGGG + Intergenic
1000655544 5:163874164-163874186 ATGCTGTCATCTAGAGAAATGGG - Intergenic
1000992645 5:167926857-167926879 ATGCTAGCTTTGGGGGAAACTGG + Intronic
1001245532 5:170103514-170103536 ATGATATTATTTGGAGAAACAGG - Intergenic
1001844154 5:174905482-174905504 CTGCTGTCATTTGGAGGAAAAGG - Intergenic
1002342907 5:178528338-178528360 AGGCTGTCATTAGCAGAAAAGGG - Intronic
1002515838 5:179758017-179758039 ACACAGTCATTGGGAGAAACTGG + Intronic
1002963679 6:1941621-1941643 CTGCTGTCAGTGAGAGAAAGGGG + Intronic
1003085169 6:3054663-3054685 ATGCCACCATTGGGGGAAACCGG + Intergenic
1003166420 6:3682859-3682881 ATGTTAACATTGGGAGAAACTGG - Intergenic
1003354200 6:5350760-5350782 ATGTTATCATGGGGAGAAATTGG + Intronic
1003907000 6:10710736-10710758 ATGTTATCATTGGGAAAACCGGG - Intergenic
1004018706 6:11756488-11756510 ATGTTACCATTGGGGGAAACTGG + Intronic
1004333879 6:14746331-14746353 ATGTGATCATTGGGGGAAACTGG + Intergenic
1004555789 6:16696512-16696534 ATGCTGACATTGTTAGAAAGGGG - Intronic
1004907166 6:20247200-20247222 AGGTTATCATTGGGGGAAACTGG + Intergenic
1005394120 6:25363810-25363832 ACGTTACCATTGGGAGAAACTGG - Intronic
1006252686 6:32802394-32802416 ATGTTATCCTTGGGGGAAACTGG - Intergenic
1007469819 6:42081969-42081991 ATGCTACCACTGGGAGAAAGTGG - Exonic
1008677977 6:53841933-53841955 ATGTTACCATTGGGAAAAACTGG - Intronic
1009977484 6:70687693-70687715 ATGTTACCATTAGGAGAAACTGG - Intronic
1012402908 6:98859098-98859120 ATCCTGGCTATGGGAGAAACAGG + Intergenic
1012554514 6:100495297-100495319 ATGTTTTCAATGGGATAAACTGG + Intergenic
1012956648 6:105577745-105577767 ATGTTGCCACTGGAAGAAACTGG - Intergenic
1013152185 6:107457310-107457332 ATGTTACCATTGGGAGAAACAGG + Intronic
1013906768 6:115229358-115229380 ATCCTGTCATTTGCAGCAACGGG - Intergenic
1014568775 6:122983610-122983632 ATGTTACCATTGGGAGAAACTGG + Intergenic
1014716754 6:124874456-124874478 ATGTTACCATTGAGAGAAACTGG - Intergenic
1014776328 6:125514164-125514186 ATGTTATTATTGGGGGAAACTGG - Intergenic
1015155694 6:130093208-130093230 ACGTTAACATTGGGAGAAACTGG + Intronic
1018181950 6:161231481-161231503 ATGCTACCATAGGGAGAAACTGG + Intronic
1019629313 7:2038895-2038917 ATGTTGCTATTGGGAGGAACTGG - Intronic
1020931409 7:14401067-14401089 ATGTTGTCACTGGCAGAATCAGG - Intronic
1021858576 7:24882490-24882512 ATGCAATCATTGGTGGAAACAGG + Intronic
1022039846 7:26570370-26570392 ATGCTATCATTTGGGGAAACAGG + Intergenic
1022840646 7:34160918-34160940 ATTCTGCCACTAGGAGAAACGGG + Intergenic
1022859519 7:34352801-34352823 ATATTGTCATTGAGGGAAACTGG + Intergenic
1022865406 7:34413539-34413561 ATGTTGCCATTGGTGGAAACTGG - Intergenic
1023805730 7:43871580-43871602 ATACTGTGATTGGGGGAAAGGGG + Intronic
1024366250 7:48523449-48523471 ATATTATCATTGGGAGAAGCTGG - Intronic
1025734572 7:64135701-64135723 ATGCTATCTATGGGAGCAACTGG - Intronic
1028186218 7:87788465-87788487 ATAATTTCATTGGGAGACACAGG + Intronic
1028274130 7:88830605-88830627 ATGTTATCATTGGAAGAAGCTGG - Intronic
1028552748 7:92088888-92088910 ATGGTATCATTGGGAAAAGCTGG + Intronic
1028669959 7:93390487-93390509 ATGTTGCCATTGGGGAAAACTGG + Intergenic
1030194708 7:106842073-106842095 ATGATGTCATTGACTGAAACAGG + Intergenic
1030627663 7:111861247-111861269 ATGTTTTTATTGGGAGAAATCGG + Intronic
1030863460 7:114667843-114667865 ATTCTGAAATTGGGAGAGACTGG + Intronic
1030927359 7:115475433-115475455 TTGCTGTCACTGGGAGGAAGTGG - Intergenic
1031550888 7:123110260-123110282 CTCCTGAAATTGGGAGAAACAGG + Intergenic
1032003139 7:128278934-128278956 ATGTTACCATTGGGAGAAACTGG + Intergenic
1032384110 7:131509583-131509605 ACGCTGTCATTGGGAAAACGAGG + Exonic
1032858794 7:135858733-135858755 ATCCGGTCATTGGGAGCATCAGG + Intergenic
1033054072 7:138033483-138033505 AGGCTGTCATGGTGAAAAACAGG - Intronic
1033173880 7:139108192-139108214 AAGCTCTCTTAGGGAGAAACTGG + Intronic
1033824317 7:145170897-145170919 GTTCTGTCATTGGGCTAAACTGG + Intergenic
1035401239 7:158567330-158567352 ATTCTGTCACTGTGACAAACAGG + Intronic
1037229698 8:16642738-16642760 ATTTTACCATTGGGAGAAACTGG - Intergenic
1037952664 8:23029000-23029022 TTGCTGTGATTGGGGGAAATGGG - Intronic
1040440668 8:47438240-47438262 CTGCTGTCAGTGGGAGACAGGGG + Intronic
1040564552 8:48553980-48554002 ATGCTATCTTTGGTAGAAATTGG + Intergenic
1041308614 8:56490468-56490490 ATGTTACCATTGGAAGAAACTGG + Intergenic
1041980901 8:63858260-63858282 ATGTAGTCATTGGGGGAAATGGG - Intergenic
1042292197 8:67180684-67180706 ATGTTACCATTGGGGGAAACTGG + Intronic
1042522900 8:69733359-69733381 ATGCTGACATAGAGAGAGACAGG + Intronic
1043284674 8:78514512-78514534 ATGATGTCAATAGGAGACACTGG + Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1045257102 8:100535406-100535428 ATGTTACCATTGGGGGAAACTGG - Intronic
1045322815 8:101094897-101094919 ATGGAGACATTGGGAGAAAATGG - Intergenic
1045357311 8:101401023-101401045 ATGCTAACATTAGGAGAAGCTGG + Intergenic
1046076216 8:109315288-109315310 ATCCTGTGCTTGGGAGAAACAGG - Intronic
1046242383 8:111513114-111513136 ATGCTGTCATTTGCAACAACAGG + Intergenic
1047065449 8:121277095-121277117 ATGTTACCATTGGGGGAAACTGG - Intergenic
1047175062 8:122532674-122532696 ATGCTGTCACTGGAAAAAAGAGG + Intergenic
1048316623 8:133367858-133367880 AAGCTGTCAGTGTGAGACACGGG + Intergenic
1051887394 9:21907906-21907928 ATGTTACCATTGGGAGAAACTGG - Intronic
1052000626 9:23275192-23275214 ATACTGAAATTTGGAGAAACAGG + Intergenic
1055310586 9:74975502-74975524 ATGCTATCTTTGGGGGAAGCTGG + Intergenic
1055719049 9:79150916-79150938 TTGCTATCTTTGGGAGAAAGGGG + Intergenic
1056444257 9:86649413-86649435 ATATCATCATTGGGAGAAACAGG - Intergenic
1057107674 9:92435424-92435446 ATGTTATCATTAGGGGAAACTGG - Intronic
1057425979 9:94950148-94950170 ATGCTGTCATGGGGGAAAGCTGG - Intronic
1058424461 9:104864381-104864403 TTTCTGTTCTTGGGAGAAACAGG + Intronic
1058571339 9:106348621-106348643 ATGTTGACATTGGGGAAAACTGG + Intergenic
1058901430 9:109445984-109446006 GTGGAGTCATTGGCAGAAACAGG - Intronic
1059431230 9:114251567-114251589 ATGCTACCACTGGAAGAAACAGG - Intronic
1059526791 9:114999564-114999586 ATACTACCATTGGGGGAAACTGG - Intergenic
1060037478 9:120268533-120268555 ATGCTGCCATTGGGGGAAACTGG + Intergenic
1060271833 9:122149095-122149117 ATTATTTCATTGGGAGAAAGAGG - Intronic
1062034916 9:134378719-134378741 AGGCTGCCTTTGGGAGCAACCGG - Intronic
1186157735 X:6743051-6743073 ATGCTTTCAGTAGGGGAAACTGG + Intergenic
1187273945 X:17802607-17802629 TTGCTGTTACTGGGAGAAATGGG - Intronic
1187465141 X:19520284-19520306 ATGTTAACATTGGGACAAACTGG - Intergenic
1187539427 X:20177232-20177254 ATGTTACCATTGGGGGAAACTGG - Intronic
1187978069 X:24724130-24724152 ATGATGCCATTGGGAGGAATTGG + Intronic
1188249298 X:27873189-27873211 ATGTTTCCATTGGGGGAAACTGG - Intergenic
1188321188 X:28739147-28739169 AAGCTGTCATGGGAAGAAATGGG - Intronic
1188570216 X:31576097-31576119 ATGCTATCATTGGGAGAAGCTGG - Intronic
1188707647 X:33355753-33355775 ATGTTATCATTGGGAGAAACTGG - Intergenic
1189964296 X:46355745-46355767 ATGTTATCATTGGATGAAACTGG + Intergenic
1190892340 X:54581145-54581167 ATGTTACCATTGGGGGAAACTGG - Intergenic
1191254064 X:58272275-58272297 GTGCCTTCAGTGGGAGAAACAGG + Intergenic
1192254776 X:69447148-69447170 ATGTTACCATTGGGGGAAACTGG - Intergenic
1192813814 X:74571134-74571156 ATGTAGCCATTGGGGGAAACTGG + Intergenic
1192960035 X:76120000-76120022 ATACTGTCATTTGCAGCAACAGG + Intergenic
1193100042 X:77600138-77600160 ATGCTGATATTAGAAGAAACTGG + Intronic
1194475437 X:94353618-94353640 ATGTTACCATTGGCAGAAACTGG + Intergenic
1195066316 X:101241369-101241391 ATGTTGTCATTTGGGGAAACTGG + Intronic
1195102949 X:101573950-101573972 AGGCTGACACTGGGAGACACAGG - Intergenic
1195525004 X:105877469-105877491 ATGTTAACATTGGAAGAAACTGG + Intronic
1195549950 X:106157147-106157169 ATTATGTAAATGGGAGAAACTGG + Intergenic
1196370003 X:114966965-114966987 ATGATGTCATTAACAGAAACTGG + Intergenic
1196372325 X:114993609-114993631 ATGTTGTCATTAGAGGAAACTGG + Intergenic
1196643649 X:118092835-118092857 ATGTAGTCATTTGGGGAAACTGG + Intronic
1196755979 X:119157661-119157683 ATGTTACCATTGGGGGAAACTGG - Intergenic
1196928544 X:120658432-120658454 ATGGTGTCATTAGGAGAACCTGG + Intergenic
1196936069 X:120732282-120732304 ACACTGTCATTGGGGGAAACCGG + Intergenic
1197841998 X:130758124-130758146 ATGCTACCATTGGGAGAAAATGG - Intronic
1198789177 X:140324171-140324193 ATGCTATCATTGGAAAAAACTGG + Intergenic
1198794573 X:140381816-140381838 ATTCTATAATTTGGAGAAACAGG + Intergenic
1199171354 X:144737930-144737952 GTGCTATTATTGGGAGAGACTGG - Intergenic
1201611320 Y:15846077-15846099 TTTCTGTCATTGTGGGAAACTGG - Intergenic