ID: 1177446181

View in Genome Browser
Species Human (GRCh38)
Location 21:21199178-21199200
Sequence CAGGATATTTTTTTGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177446176_1177446181 7 Left 1177446176 21:21199148-21199170 CCTCCACTTCTAAGGAACATCTA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1177446181 21:21199178-21199200 CAGGATATTTTTTTGGATTCAGG 0: 1
1: 0
2: 1
3: 23
4: 327
1177446175_1177446181 10 Left 1177446175 21:21199145-21199167 CCTCCTCCACTTCTAAGGAACAT 0: 1
1: 0
2: 0
3: 19
4: 267
Right 1177446181 21:21199178-21199200 CAGGATATTTTTTTGGATTCAGG 0: 1
1: 0
2: 1
3: 23
4: 327
1177446177_1177446181 4 Left 1177446177 21:21199151-21199173 CCACTTCTAAGGAACATCTAATA 0: 1
1: 0
2: 1
3: 14
4: 177
Right 1177446181 21:21199178-21199200 CAGGATATTTTTTTGGATTCAGG 0: 1
1: 0
2: 1
3: 23
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177446181 Original CRISPR CAGGATATTTTTTTGGATTC AGG Intronic
900930177 1:5731445-5731467 CTGGGTTTTTGTTTGGATTCAGG + Intergenic
901799404 1:11698921-11698943 CAGGAGATTTTGTTGAATGCAGG - Intronic
902582050 1:17413964-17413986 AAGGATATTTCTTTGGTTTTTGG - Intronic
904191378 1:28746665-28746687 CAGGATAATTTCTTGGACCCGGG + Intronic
904243195 1:29165031-29165053 CAGGGTTTTTTTTGGGATTTGGG - Intronic
907095614 1:51777491-51777513 CAGGAAATTTTTTTGTAATGGGG + Intronic
907810585 1:57865875-57865897 CAGAATATTTTTTATAATTCTGG + Intronic
908119211 1:60969931-60969953 CTGAATCTCTTTTTGGATTCCGG + Intronic
909568060 1:77077755-77077777 CAGAATAAGTTTTTGGATTTTGG + Intergenic
910436850 1:87213955-87213977 CATGGTATTTTTTAGGATTTGGG - Intergenic
910470015 1:87542005-87542027 CAGGATAGTTTTGAGTATTCTGG + Intergenic
911654914 1:100432978-100433000 CAGGAGAATTGTTTGAATTCAGG - Intronic
912169414 1:107080411-107080433 CAGGATTTTTTTTTGGAAAGAGG - Intergenic
915651443 1:157314445-157314467 CATGATATTTTTTTTATTTCTGG - Intergenic
916709487 1:167390951-167390973 CAGGAAATTAATTTGGATTTTGG - Intronic
918152437 1:181809535-181809557 CAGGATACTTTCTTGGCCTCTGG - Intergenic
919149912 1:193682846-193682868 CAGGATTTTTTTTTTAATTTGGG - Intergenic
920153211 1:203926129-203926151 CAGGAGAATTGTTTGAATTCGGG + Intergenic
920947195 1:210540931-210540953 CAGGATAATTTCTTGGACCCAGG - Intronic
920998843 1:211022005-211022027 CAGGATAGTTTTTGCTATTCTGG - Intronic
921443337 1:215214849-215214871 CATGATTTTTTTTTGGTTTTTGG - Intronic
924156770 1:241184754-241184776 CGGGGTTTTTTTTTGGATTTTGG - Intronic
1062840710 10:669110-669132 CAGCATTTTTCCTTGGATTCTGG - Intronic
1064998174 10:21314543-21314565 CATAATAGTTTTTTGGACTCTGG + Intergenic
1066590297 10:36987251-36987273 CAGCTAATTTTTTTGGATTTTGG + Intergenic
1066726371 10:38400275-38400297 CCTAAGATTTTTTTGGATTCTGG - Intergenic
1069037515 10:63660907-63660929 CAGGAGAATTGTTTGGACTCAGG - Intergenic
1069537058 10:69261663-69261685 CAGGATATTTTGTGAGATTGAGG - Intronic
1069678723 10:70268348-70268370 CAGGAAATTTTGCTGGATGCTGG - Intronic
1069934820 10:71907932-71907954 CAGGAAATTTGATTGGATCCTGG + Intergenic
1072352878 10:94575582-94575604 CAGGCTAATTTTTTGTATTTTGG + Intronic
1072992613 10:100211973-100211995 CAGGATAATTGCTTGAATTCAGG - Intronic
1073821073 10:107264829-107264851 GAGGAGATTTTTCAGGATTCTGG - Intergenic
1073959154 10:108906049-108906071 CAGGTTAATTTTTGGCATTCTGG - Intergenic
1074949362 10:118314535-118314557 CACGATATTCTTTTATATTCTGG - Intronic
1074961294 10:118448353-118448375 AAGGATTTTTCTTTGGATTCAGG - Intergenic
1076057394 10:127386852-127386874 CAGGATATATTTTTGTTCTCTGG + Intronic
1077448898 11:2622203-2622225 CAGTATATTTTCTTATATTCTGG + Intronic
1078524492 11:12090226-12090248 CAGGAAGTGGTTTTGGATTCAGG - Intergenic
1078941372 11:16010074-16010096 CAGGATATTTTTTTTATTTTCGG - Intronic
1078953400 11:16161875-16161897 AAGGATATTTTATCAGATTCTGG + Intronic
1079645429 11:22859319-22859341 CAGTATATTTCTTGGGACTCTGG - Intronic
1080222071 11:29917431-29917453 CAGGTTATTTTTTTAGAGACAGG - Intergenic
1084480920 11:69419564-69419586 CAGGACATTTTTCGGGTTTCTGG + Intergenic
1084923322 11:72490790-72490812 CTAGATATTTTCTAGGATTCAGG + Intergenic
1085212634 11:74795166-74795188 CAGCATATTTTTTTGGGTGGGGG + Intronic
1086547282 11:88012524-88012546 TAGCATATTTTTCTGGCTTCTGG + Intergenic
1086831401 11:91569618-91569640 CAAGATATTTATTTGTTTTCAGG + Intergenic
1086883996 11:92182527-92182549 CTGGATTTTTGTTTGGATTGTGG - Intergenic
1087176173 11:95097990-95098012 GAAGATTTTTTTTTGGATTTTGG + Intronic
1087372038 11:97296680-97296702 CAGAATATTTTTTTGTATCTAGG + Intergenic
1087558277 11:99750638-99750660 CAGTATATTTAGTTAGATTCTGG - Intronic
1087735227 11:101825405-101825427 TCTGATATTTTTTTGGATTATGG - Intronic
1088191295 11:107231337-107231359 AAGGAAATTTTTTTTTATTCAGG - Intergenic
1088489101 11:110369583-110369605 CAGGAGATTTGCTTGAATTCTGG + Intergenic
1088507223 11:110538746-110538768 CAGGATAATTGTTTGAACTCAGG + Intergenic
1088637343 11:111835737-111835759 CCGGATATTTTTTAGGATGAGGG - Intronic
1089904936 11:122028956-122028978 TAGGATATTTTTTTGGAGCGGGG - Intergenic
1090337490 11:125982397-125982419 CAGGATTTGTTGTTGGAGTCTGG + Intronic
1090390642 11:126385037-126385059 CAGGATATGTTTTGAGACTCAGG + Intronic
1090422866 11:126587610-126587632 CCGGATTTTTATTTTGATTCAGG - Intronic
1090715630 11:129427984-129428006 GAGAATCTGTTTTTGGATTCTGG - Intronic
1090866892 11:130709372-130709394 CAGGAAATTTTTTTAAATTGTGG - Intronic
1091838588 12:3603089-3603111 TCGGATTTTTTTTTGGATTTTGG + Intergenic
1092518793 12:9244502-9244524 CAGGATTTTTTTTTTTTTTCTGG + Intergenic
1093956668 12:25228371-25228393 CAGATTTTTTTTTTGGATTTTGG - Intronic
1094189166 12:27679593-27679615 CTGGATTTCTTTTTGGAATCTGG - Exonic
1096290012 12:50334262-50334284 CAGGATAATTTCTTGAATCCAGG - Intronic
1097492294 12:60285149-60285171 CATGCTATTTTTTGTGATTCAGG + Intergenic
1098227608 12:68340835-68340857 AAGGATTCTTTTTAGGATTCTGG - Intergenic
1098766862 12:74501722-74501744 AAGAATATATTTTTGAATTCTGG + Intergenic
1100342965 12:93699031-93699053 CAGGTTTTTTTTCTGGTTTCTGG - Intronic
1106448317 13:29856632-29856654 CAGGATCTATTTTTGGGTTTTGG + Intergenic
1108006963 13:45958447-45958469 TTGGAAATTTTTTTGGATTCTGG + Intronic
1110050341 13:70888813-70888835 GAAGAAATATTTTTGGATTCTGG - Intergenic
1111565741 13:90012976-90012998 CAGGATATGTTTCTGGAAGCAGG + Intergenic
1111762692 13:92485355-92485377 CTGGCTATTATTTTGGAGTCTGG - Intronic
1111763190 13:92492595-92492617 CAGGACATTTTTATGGTTTAGGG - Intronic
1111877091 13:93910814-93910836 CAGAATATTTATTTGTTTTCAGG + Intronic
1112081143 13:95972364-95972386 CAAGATATTTGTTTGGATGAGGG - Intronic
1113291839 13:108915696-108915718 CAGAATAACTTTTTGGATTTAGG - Intronic
1115722038 14:36173014-36173036 CAGAATAATTTTTTCTATTCTGG - Intergenic
1115863509 14:37715735-37715757 AAGGATATTTTTCTGGATGTAGG - Intronic
1118239352 14:64041444-64041466 GGGGCTATTTTTTTGTATTCTGG - Intronic
1118410932 14:65477096-65477118 CAGGGTGTTTGTTTGAATTCTGG + Intronic
1119626379 14:76180101-76180123 CAGGAGAATTTTTTGAACTCGGG + Intronic
1120069229 14:80084335-80084357 CAGCACATTCTTTTGGCTTCAGG + Intergenic
1120474120 14:84965858-84965880 CCTGATATTTTTTTTAATTCTGG - Intergenic
1122553390 14:102562548-102562570 CTGGATAATTTTTTGTATTTTGG - Intergenic
1124849665 15:33324104-33324126 CAAGATACTCTTTTGGATTAAGG + Intronic
1126243683 15:46476249-46476271 CAGGATATTATTTTATATTATGG + Intergenic
1127500638 15:59550825-59550847 AAGGAAATTTTTATGGAGTCAGG - Intergenic
1131777579 15:95819087-95819109 CTGGCTAATTTTTTGTATTCTGG - Intergenic
1134582722 16:15384730-15384752 CAGGATAATTGTTTGAACTCAGG - Intergenic
1134909407 16:18010697-18010719 CATGATCTTTGTTTGGATCCTGG + Intergenic
1135314045 16:21428797-21428819 CAGGATAATTGTTTGAACTCAGG - Intronic
1135366969 16:21861075-21861097 CAGGATAATTGTTTGAACTCAGG - Intronic
1135444846 16:22510085-22510107 CAGGATAATTGTTTGAACTCAGG + Intronic
1135613614 16:23890225-23890247 AGGGATATTTTTCTTGATTCAGG - Intronic
1135826674 16:25734830-25734852 CAGGATTTATTTTGGGATGCTGG + Intronic
1135955097 16:26949763-26949785 CAGGATATTGTTTTAGGTGCTGG - Intergenic
1136193570 16:28634627-28634649 CAGGATAATTGTTTGAACTCAGG + Intergenic
1136310716 16:29407505-29407527 CAGGATAATTGTTTGAACTCAGG - Intergenic
1136324156 16:29509283-29509305 CAGGATAATTGTTTGAACTCAGG - Intergenic
1136438841 16:30249265-30249287 CAGGATAATTGTTTGAACTCAGG - Intronic
1136641065 16:31565725-31565747 GAGGATATATTTTTGGATTTGGG - Intergenic
1136663907 16:31791595-31791617 GAGGATATATTTTTGGATTTGGG + Intronic
1137886887 16:52114525-52114547 CAGGATTTTTTTTTAGATGTAGG + Intergenic
1139410178 16:66752254-66752276 CAGGATATTTATGAGGATTCTGG - Intergenic
1139756423 16:69147615-69147637 TTGGATTTTTTTTTGGATTTTGG + Intronic
1139858392 16:69999882-69999904 CAGGATAATTGTTTGAACTCAGG - Intergenic
1141121564 16:81362499-81362521 AAGGATTTTTGTTTGTATTCGGG + Exonic
1146273533 17:31499809-31499831 CAGGAGATCTTTGTGGCTTCAGG + Intronic
1147004056 17:37387537-37387559 CAGGAGAATTTCTTGGATCCGGG - Intronic
1148036384 17:44664589-44664611 CAGGTTTTTTTCTTGGATTCTGG - Intronic
1149348510 17:55763689-55763711 CAGTAGATATTTTTGGATTATGG + Intronic
1149567283 17:57649075-57649097 CAGGATGTTTCTTTGGCCTCTGG + Intronic
1149679655 17:58496547-58496569 GAGGATAGATTTTTGGGTTCCGG - Intronic
1149872737 17:60197509-60197531 CAGGAGATTTTTTTGAACCCAGG + Intronic
1150799708 17:68270974-68270996 CAGCATATTTTTTGGGTTTATGG - Exonic
1151174173 17:72273629-72273651 GAGGATTTTTTTTTGGTTTTTGG + Intergenic
1153196684 18:2606687-2606709 AAGGACATTTTTCTGGATTAGGG + Intronic
1154119842 18:11643171-11643193 CAGGATAATTGTTTGAACTCAGG - Intergenic
1155028176 18:21961223-21961245 CTGGCTATTTTTTTGCATTTTGG - Intergenic
1156120585 18:33837828-33837850 CAAGATTTTTTTTTAAATTCTGG + Intergenic
1156231126 18:35154760-35154782 TAGTTTATTTTTTTGGATTAAGG - Intergenic
1156413149 18:36855970-36855992 CAGGATTTTTTTTTTCTTTCAGG + Intronic
1157760949 18:50265426-50265448 CAGATTTTTTTTTTGGATTTTGG - Intronic
1158282109 18:55839609-55839631 CAGAATATCTTTGTGGTTTCTGG - Intergenic
1158380627 18:56926126-56926148 CAGGATAGTTTTCTGGATACAGG + Intronic
1159173370 18:64802279-64802301 CAGGATAATTGTTTGAAATCGGG - Intergenic
1162094653 19:8303207-8303229 CAGGATAATTGTTTGAACTCAGG - Intronic
1163525477 19:17818318-17818340 CAGGATATTTTTTTGAGGCCAGG + Intronic
1165024189 19:32947650-32947672 CTGGCTACTTTTTTGTATTCTGG + Intronic
1165529772 19:36388466-36388488 CAGGGTTTTTTTTTGGTATCTGG + Intronic
1165954225 19:39491855-39491877 TAAGATTTTTTTTTGGAGTCAGG + Intronic
925623943 2:5823562-5823584 CAGTATTTTTGTATGGATTCTGG + Intergenic
925792229 2:7502277-7502299 CAGGCTATATTTTTGCATTAAGG - Intergenic
927268681 2:21182297-21182319 CAGGGGACTTCTTTGGATTCTGG - Intergenic
927386765 2:22543501-22543523 TTGGATATATTTTTGGATGCTGG - Intergenic
929150381 2:38742452-38742474 CAGCATATTTTTTTTGAGGCAGG - Intergenic
929183343 2:39067417-39067439 GAGGTTTTTTTTTTGGATTTTGG - Intronic
930990563 2:57649306-57649328 TAGAATTTTTTTTTGGTTTCAGG + Intergenic
932622659 2:73274612-73274634 CAGAATATTTTTTAGAATTAAGG + Intronic
933124816 2:78591866-78591888 GAGGATTTTATTTTGTATTCTGG - Intergenic
933273409 2:80258297-80258319 CAGGTTATTTTTTTGCACTTAGG + Intronic
935207748 2:100911180-100911202 CAGGATAATTTTTTAAATGCAGG - Intronic
935227568 2:101066850-101066872 CAGGAGAATTTCTTGAATTCAGG + Intronic
935803557 2:106724322-106724344 CAACATACTTTTTTGGATCCTGG + Intergenic
937015919 2:118605374-118605396 CAGGACATTTTTCTAGATCCTGG + Intergenic
937476807 2:122222623-122222645 CATTTTATTTCTTTGGATTCAGG + Intergenic
937636276 2:124158688-124158710 GAGGATATTTTATTTGTTTCTGG + Intronic
937642772 2:124232382-124232404 CTGGATATGTTGTTGGATACTGG + Intronic
937668339 2:124512523-124512545 CATGGTATTTTCTTGGTTTCTGG - Intronic
939729742 2:145767873-145767895 CAGGATATTTTGTTTGCTTTAGG - Intergenic
939755195 2:146101428-146101450 AAGGATAATTTGTTGCATTCTGG + Intergenic
939959835 2:148556819-148556841 CTGGAAATTTTTTTGGCTTGGGG + Intergenic
940152753 2:150621023-150621045 CAAGATATTTATTGGGATACAGG - Intergenic
940864350 2:158802807-158802829 AAGAACCTTTTTTTGGATTCTGG + Intronic
941344498 2:164350439-164350461 CAGGTTAATATTTTGCATTCTGG - Intergenic
942136515 2:172931323-172931345 CAGGATATTTTTCTAGCTTGCGG + Intronic
942144147 2:173009580-173009602 CAGATTTTTTTTTTGGATTTTGG - Intronic
943026101 2:182630421-182630443 CAGGATCTATTTTCAGATTCTGG + Intergenic
943040031 2:182793371-182793393 CAGGATCTTCTTTTTGGTTCTGG - Exonic
943248092 2:185482355-185482377 CAGCATATTTTTTAGTACTCTGG - Intergenic
943429634 2:187783135-187783157 CAGTATCTTTTTTAGCATTCAGG + Intergenic
944074730 2:195716073-195716095 CAGCATAGCTTTTTGGGTTCTGG + Intronic
944097602 2:195986415-195986437 CAGGATATATTTTATGATTATGG - Intronic
944200416 2:197101151-197101173 CAGGATATTTGATTGGATCCTGG - Intronic
944249496 2:197567141-197567163 CCGGATATTTTTTTGGAGGTGGG + Intergenic
944693124 2:202176118-202176140 CAGAATATTTTTATGAATTTTGG + Intronic
945878249 2:215300508-215300530 CTGGATTTTTTTATGAATTCTGG + Intergenic
947206072 2:227662346-227662368 CAGGATTTTTTTTTGGGTTGGGG + Intergenic
947728073 2:232412262-232412284 CAGGACAGTTTTTTCAATTCTGG + Intergenic
947983097 2:234426569-234426591 AAGGATCCTTTCTTGGATTCTGG - Intergenic
948171758 2:235909399-235909421 AAGGAGATTTTTTTTCATTCAGG + Intronic
1168862321 20:1054723-1054745 CAGGATAATTGCTTGAATTCGGG - Intergenic
1169578154 20:6989304-6989326 CAGTATATATTTTTGCATTCTGG - Intergenic
1169578814 20:6995941-6995963 CAGGAGATTTATTTTGAATCAGG + Intergenic
1169584753 20:7068758-7068780 CGGGCTATTTTTTTGTATTTTGG - Intergenic
1171131668 20:22659549-22659571 TAAGATATTTTGTTGCATTCTGG - Intergenic
1171289760 20:23975663-23975685 CAGGAGAATCTTTTGAATTCAGG - Intergenic
1176208716 20:63906032-63906054 CAGGATTTTTTTTTTAATTAAGG + Intronic
1177446181 21:21199178-21199200 CAGGATATTTTTTTGGATTCAGG + Intronic
1178011619 21:28293273-28293295 CAGTATATTTGTTTGGATTTAGG - Intergenic
1178605323 21:34031270-34031292 CAGGAGAATTGTTTGAATTCGGG + Intergenic
1180026523 21:45166117-45166139 CAGGATATGTTTTTTCATTAAGG + Intronic
1181137280 22:20777307-20777329 CAGGAGATTCGTTTGAATTCAGG - Intronic
1181561372 22:23703826-23703848 CAGGATTTTTTTATAGTTTCAGG - Intergenic
1181940077 22:26468936-26468958 CTGCATACTTTTTGGGATTCTGG - Intronic
1182634747 22:31716763-31716785 AAGGATATTGTTCTGGATTCTGG + Exonic
949134775 3:551046-551068 CAGCATTTTTTTTTAAATTCGGG + Intergenic
950388655 3:12679143-12679165 CAGGATAATTTTTTGAACCCGGG - Intergenic
950822531 3:15776467-15776489 CAGTATATTTTCTTCGAGTCTGG - Intronic
951145592 3:19222785-19222807 CAGGATATTTTTTAGGATGAAGG + Intronic
951310403 3:21118087-21118109 CAGAATATTTGATTTGATTCTGG - Intergenic
953192722 3:40702829-40702851 CTGGATTTTGTTTTGGATTTTGG + Intergenic
953547917 3:43877799-43877821 CAGGATACTTTTTTGGTGTGGGG - Intergenic
954311413 3:49771154-49771176 TAGGAAGTTTTTTTGTATTCTGG - Intronic
955176794 3:56623515-56623537 GAGGATATGTCTCTGGATTCAGG - Exonic
956633008 3:71334497-71334519 CAGAATATTTTTTTAATTTCAGG - Intronic
957686229 3:83505998-83506020 CAGGATAGTTTTGTCTATTCTGG - Intergenic
959305121 3:104653758-104653780 CAGGAGAGTTGTTTGGACTCAGG - Intergenic
959348594 3:105231778-105231800 CAAGATTTTATTTTGAATTCTGG + Intergenic
959850615 3:111082438-111082460 CAGAATTTTTTTTTAGATTGAGG + Intronic
960082024 3:113552179-113552201 CAGGATATTTTTTAGAAGGCAGG - Intronic
960592705 3:119380941-119380963 CTGGATAACATTTTGGATTCGGG - Exonic
960879400 3:122329407-122329429 CTGGCTATTTTTTTGTATTTTGG - Intronic
961143215 3:124573029-124573051 CAAGACATTTTTTTGGAGACAGG - Intronic
962282832 3:134065272-134065294 CTGGCTTTCTTTTTGGATTCAGG - Intergenic
962635241 3:137324737-137324759 TAAGATATTTTTTTAGTTTCAGG + Intergenic
962892737 3:139686704-139686726 CTGGCTATTATTTTAGATTCTGG - Intergenic
964013143 3:151914715-151914737 CAGGATATTTTCTCTTATTCAGG - Intergenic
964578410 3:158201686-158201708 CAGAATTTTTTTTCGTATTCTGG + Intronic
964907403 3:161734506-161734528 CAGAATCTTTCTTTGGTTTCTGG - Intergenic
965116693 3:164499549-164499571 CAAAATATTATTTTGGATTTAGG + Intergenic
965454166 3:168876784-168876806 CAGGTTATTTATTTGCAATCTGG - Intergenic
966061786 3:175766180-175766202 CAAGATAATTTTATTGATTCAGG - Intronic
969726780 4:8922864-8922886 CAGGAAAGTCTTCTGGATTCAGG + Intergenic
970200799 4:13602543-13602565 CAGCATATTTTTCTGTATTCAGG + Exonic
970768914 4:19586129-19586151 CAGTATTTTCTTTTGGAGTCAGG + Intergenic
971360095 4:25930094-25930116 CTTGAGATTTTTTTGGATTTTGG + Intergenic
974802108 4:66830857-66830879 CATGATATTTTTCTGAGTTCTGG - Intergenic
974860807 4:67519421-67519443 CTTGATATTTTTTTCGAGTCAGG + Exonic
974991697 4:69099538-69099560 CAGGAAATTTTGCAGGATTCAGG + Intronic
976789920 4:88866603-88866625 GAGGATTTTTTTTTGTATTCTGG - Intronic
977186473 4:93944432-93944454 CAAGAATTTTTTTTGGATTAGGG - Intergenic
977958992 4:103063252-103063274 TAGTGTATATTTTTGGATTCTGG + Intronic
979205342 4:118032355-118032377 CCGGATAATTTTTTGTATTTTGG - Intergenic
979963108 4:127045145-127045167 AGGGATATTTATTTGGCTTCTGG - Intergenic
980436779 4:132786181-132786203 CAGGATATTTTGCTGGTTTTGGG + Intergenic
980640830 4:135576912-135576934 CAGCTTATTTTTTTGTATTTTGG - Intergenic
980804893 4:137799657-137799679 AAGGATATTTCTTTGTATTTTGG + Intergenic
981211525 4:142111834-142111856 CAGGAGAATTTTTTGAACTCGGG - Intronic
981821613 4:148893740-148893762 CAGAGTATTTTTGTGGAGTCAGG + Intergenic
982751125 4:159163281-159163303 CAGGATATTATTGGGGGTTCTGG - Intronic
982805829 4:159761111-159761133 CAGAATTTTTTTTTTGATACAGG - Intergenic
983013692 4:162582118-162582140 CAGGACATTTTTATAAATTCTGG + Intergenic
983378054 4:166955055-166955077 AAGGTTATTTTTTTGAATCCAGG + Intronic
985337940 4:188915975-188915997 CAGGATATTTAATTGGAGGCAGG - Intergenic
986339447 5:6776621-6776643 GAGTACATTTTTTTGAATTCTGG + Intergenic
986495082 5:8333297-8333319 CAGGTTACTTTTTTGGCTTCTGG - Intergenic
987132926 5:14875163-14875185 GGGGATATCTTTTTGGCTTCTGG - Intergenic
989577913 5:43006058-43006080 AAGGACATTTTAGTGGATTCAGG + Intergenic
990682167 5:58257135-58257157 AAGGATTTTTTTTTAAATTCTGG - Intergenic
992367512 5:76108076-76108098 CAGGATACTTTTTTGGATGTTGG + Intronic
993444718 5:87996938-87996960 CAAGATATTATTTTGGCTTCTGG - Intergenic
993559485 5:89387305-89387327 TAGGATATTTTTATGATTTCTGG + Intergenic
994676307 5:102827310-102827332 TTGGATTTTTTTTTGGATTTTGG - Intronic
994895528 5:105697726-105697748 AAGGAGATTATTTTGGATTAAGG - Intergenic
994947324 5:106412457-106412479 CAAAATACTTTTTAGGATTCTGG - Intergenic
995062862 5:107830634-107830656 CAGGAAATTTTTTTCTAGTCTGG - Intergenic
995513523 5:112931314-112931336 CAGCATATTTTGTTGGAGTCAGG + Intergenic
995781460 5:115780515-115780537 CAGGACATATTTTAGTATTCTGG + Intergenic
995931446 5:117451235-117451257 AAGGAAATTTTTTTGAATTTGGG - Intergenic
996792432 5:127307138-127307160 CAGTATTTTTTTTAGTATTCTGG - Intronic
997988517 5:138524362-138524384 CACTATATTTTTTTGGTTTTTGG - Intronic
999752311 5:154637817-154637839 CAGGTTATAGTTTTGGAATCTGG + Intergenic
1001474682 5:172042047-172042069 CAGGTTGTTCTTTTGGATTGGGG - Intergenic
1001615975 5:173044064-173044086 CAGGATACCTTTTTGGTTTAAGG + Intergenic
1004322635 6:14644474-14644496 CAAGATCTCCTTTTGGATTCAGG - Intergenic
1006767057 6:36515786-36515808 TAGGATAATTTTTTGGACTCGGG + Intronic
1007517461 6:42424513-42424535 TTGGATTTTTTTTTGGATTTTGG - Intronic
1008287442 6:49671065-49671087 CAGTATTTTTTTTAGGATTTTGG - Intergenic
1008441105 6:51532619-51532641 AAAGCTGTTTTTTTGGATTCTGG + Intergenic
1008445917 6:51590640-51590662 CAGGATAATTGTTTGAACTCGGG - Intergenic
1008969409 6:57349087-57349109 CAGTTTAGTTTTTTGGTTTCTGG - Intronic
1009158382 6:60250918-60250940 CAGTTTAGTTTTTTGGTTTCTGG - Intergenic
1009290936 6:61881398-61881420 CATGATAGTCTTTTGCATTCAGG + Intronic
1009588093 6:65632102-65632124 CAGGATTTTTTTTTGGTTTTTGG - Intronic
1009654183 6:66518861-66518883 CATGACATTGTTTTGGATTAAGG + Intergenic
1010415474 6:75606777-75606799 CAGATTTTTTTTTTGGATTTTGG - Intronic
1010637087 6:78273623-78273645 AAGCATTTTTTTTTGGATTTGGG - Intergenic
1012079219 6:94735232-94735254 AATGACATTTTTTTGGATACGGG + Intergenic
1012682914 6:102205524-102205546 CAGAATATATATTTGGATTGTGG - Intergenic
1013780693 6:113725724-113725746 CAGGAGATTTTCTTGAGTTCAGG - Intergenic
1014508419 6:122289279-122289301 AAAAATATTTATTTGGATTCTGG + Intergenic
1015154496 6:130076468-130076490 TAGGTTATTTCTTTGGTTTCTGG + Intronic
1015346510 6:132165760-132165782 CAGGAAGTTCTTTTGGCTTCTGG - Intergenic
1016156976 6:140822844-140822866 AAGGATTTTTTTTTAAATTCTGG + Intergenic
1020622861 7:10538580-10538602 CTGAATATTTTATTTGATTCAGG + Intergenic
1022178931 7:27899440-27899462 GTGGATATTTTTTTGGAGACAGG + Intronic
1024161939 7:46685079-46685101 CAGGATAATTTCTTGTAATCAGG + Intronic
1025217901 7:57075201-57075223 CCTAAGATTTTTTTGGATTCTGG - Intergenic
1025628811 7:63248837-63248859 CCTAAGATTTTTTTGGATTCTGG - Intergenic
1025653451 7:63495259-63495281 CCTAAGATTTTTTTGGATTCTGG + Intergenic
1028934636 7:96451475-96451497 CAGGAAATGGCTTTGGATTCGGG - Intergenic
1029846637 7:103418693-103418715 CAAGTTATTTTTTTGGAAACTGG + Intronic
1030935183 7:115576972-115576994 TAGGTTTTTTTTTTGCATTCAGG - Intergenic
1031382771 7:121108694-121108716 TAGGATATTTTTATGGAATATGG + Intronic
1033070378 7:138196413-138196435 CAGGAGAATTGTTTGAATTCAGG + Intergenic
1033851477 7:145501853-145501875 AAGGATCTTTTATTGTATTCCGG + Intergenic
1035039903 7:155919956-155919978 CAGGATGTTTTGTTACATTCAGG - Intergenic
1035528969 8:336517-336539 AAGGATAGTTTATTGGATTAGGG - Intergenic
1035845413 8:2858867-2858889 CAGGAGTTGTTTTTGGACTCAGG - Intergenic
1036531512 8:9593564-9593586 CAGGTTAGTTTTTTGGTTTGGGG - Intronic
1037308179 8:17527846-17527868 CAGCATATTTTTCTGGATGGAGG + Intronic
1037316663 8:17605765-17605787 CAGGATGTTTTTCTGGTATCTGG + Intronic
1040097490 8:43460064-43460086 CAGGAAATTTTTTTATTTTCTGG + Intergenic
1041069062 8:54108705-54108727 CAGGATTTTTTTTTGGTTTAAGG + Intergenic
1041757576 8:61331054-61331076 CAGGATCTTGTTCTGGATCCTGG - Intronic
1041920458 8:63177242-63177264 CAGGATTATTTTTAGGATTATGG + Intronic
1042342831 8:67698228-67698250 CAGGTTATTTTTATGCAGTCAGG - Intronic
1043249308 8:78050386-78050408 CAAGAAATTTTTATGGCTTCAGG + Intergenic
1044091868 8:88011979-88012001 CAGGATATTTATATGGCCTCAGG - Intergenic
1045374093 8:101553787-101553809 CAGGCTAATTTTTTGTATTTTGG + Intronic
1045730731 8:105237514-105237536 CAGTATATTTTTTGTAATTCAGG + Intronic
1046778815 8:118193421-118193443 TAGGATAATTTTCTGGATTCAGG + Intronic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1048986230 8:139736592-139736614 CAGGACATCCTTTTGAATTCAGG - Intronic
1049941557 9:550871-550893 CAGGAAATTATTCTGGAGTCTGG - Intronic
1050489582 9:6173521-6173543 CAGGACAGTCTTCTGGATTCAGG + Intergenic
1051920046 9:22254016-22254038 CAGGATTTTTTTTTAGCCTCTGG - Intergenic
1052318770 9:27144598-27144620 CAGGATTTTTTTTTTAATTGAGG + Intronic
1056354438 9:85784411-85784433 CAGGATTTTTTTTTAGAGTTGGG + Intergenic
1056924715 9:90823670-90823692 CAAAATATTTTTTTAGATTTTGG - Intronic
1058359382 9:104125401-104125423 CAGATTTTTTTTTTGGATTTTGG - Intronic
1058860324 9:109111970-109111992 TAGGAAATTCTTTTGGCTTCTGG + Intronic
1059086293 9:111306308-111306330 TAGGTTATTTTTGTGGATTGTGG - Intergenic
1186144079 X:6607500-6607522 CAGATTTTTTTTTTGGATTTTGG - Intergenic
1186300156 X:8191718-8191740 CAGGAAATTTTTTAGGATTCTGG - Intergenic
1186445901 X:9628638-9628660 CAGGATAATTATTTGAATCCAGG - Intronic
1187331744 X:18346796-18346818 CAGTATTTTTTTTTGCATTTAGG - Intronic
1187578446 X:20582640-20582662 CAGGACATTTTTTTGAAAACTGG + Intergenic
1187627207 X:21129107-21129129 GAGGATATTTTTTGGTATCCTGG - Intergenic
1188031159 X:25265849-25265871 AAGGAAATTATTTTGGATTGAGG + Intergenic
1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG + Intronic
1190281547 X:48934369-48934391 CAGGATATTTTTGTGAGTTAGGG + Intronic
1190914911 X:54804177-54804199 TAGGAGATATTATTGGATTCAGG - Intergenic
1191123759 X:56932758-56932780 GAGGACATTTTTTTGCATTTTGG + Intergenic
1193591816 X:83397646-83397668 CAGGATATATTATTTTATTCTGG - Intergenic
1194123008 X:89982746-89982768 AAGGATAATTTTTTGGATATAGG - Intergenic
1194464373 X:94214261-94214283 ACTGATATTTTTTTAGATTCAGG - Intergenic
1194684351 X:96894298-96894320 CAGGAAATTCTTTTGGAAGCTGG - Intronic
1195495587 X:105528870-105528892 CATGATCTTTGCTTGGATTCCGG - Intronic
1195787130 X:108538878-108538900 GAGGATATTTTTCTGGCTTGAGG + Intronic
1195903904 X:109825723-109825745 CAGGAAATTTTTTTAGAGCCAGG - Intergenic
1196925271 X:120628076-120628098 CTGGCTAATTTTTTGGATTTTGG - Intronic
1197216870 X:123874785-123874807 CAGGAGAATTGTTTGAATTCGGG - Intronic
1197273280 X:124449183-124449205 CAGTAGATTTTTTTGGAGGCAGG - Intronic
1198734404 X:139770725-139770747 CTGGTTATTTGTTTGGAGTCGGG - Intronic
1199111166 X:143936646-143936668 CAGGTTAGTTTTGTGTATTCTGG - Intergenic
1200182218 X:154157505-154157527 GAGGATCTTTTTTAGGTTTCTGG + Intronic
1200187872 X:154194619-154194641 GAGGATCTTTTTTAGGTTTCTGG + Intergenic
1200193522 X:154231759-154231781 GAGGATCTTTTTTAGGTTTCTGG + Intronic
1200199277 X:154269563-154269585 GAGGATCTTTTTTAGGTTTCTGG + Intronic
1200475868 Y:3640182-3640204 TAGGATAATTTTTTGGATATAGG - Intergenic
1200669324 Y:6067568-6067590 CAGGAAATTTTTTTTTTTTCAGG + Intergenic
1201799040 Y:17934159-17934181 CAGGATAATTGTTTGAAATCAGG + Intergenic
1201802513 Y:17971797-17971819 CAGGATAATTGTTTGAAATCAGG - Intergenic
1202360337 Y:24102683-24102705 CAGGATAATTGTTTGAAATCAGG + Intergenic
1202510440 Y:25567433-25567455 CAGGATAATTGTTTGAAATCAGG - Intergenic