ID: 1177449023

View in Genome Browser
Species Human (GRCh38)
Location 21:21240725-21240747
Sequence CAGTGTCATTTTAAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177449023_1177449028 5 Left 1177449023 21:21240725-21240747 CCTTGTCCCTTAAAATGACACTG 0: 1
1: 0
2: 1
3: 17
4: 357
Right 1177449028 21:21240753-21240775 TGGTTAAGTAAAAATTCTTCAGG 0: 1
1: 0
2: 0
3: 27
4: 256
1177449023_1177449029 23 Left 1177449023 21:21240725-21240747 CCTTGTCCCTTAAAATGACACTG 0: 1
1: 0
2: 1
3: 17
4: 357
Right 1177449029 21:21240771-21240793 TCAGGATTTATAGTGAATTTAGG 0: 1
1: 0
2: 0
3: 19
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177449023 Original CRISPR CAGTGTCATTTTAAGGGACA AGG (reversed) Intronic
900433233 1:2612613-2612635 CAGGCTCATTTAGAGGGACAGGG + Intronic
901155124 1:7131270-7131292 CAGCGTCATTTGAAGAGAAAAGG + Intronic
902218776 1:14951397-14951419 CAAAGTCATATTAAGAGACAGGG - Intronic
906723329 1:48025051-48025073 CAGAGTCTTTTAAAGGGGCAGGG - Intergenic
906750427 1:48253764-48253786 CAGTTTCCTTTTAAGTGACTTGG - Intergenic
907727717 1:57035395-57035417 CATTTTCATTATATGGGACATGG - Intronic
909749985 1:79147269-79147291 CAATGTCATTTTCAGGGGCATGG - Intergenic
910167537 1:84343540-84343562 CCATGTCATTTGCAGGGACATGG + Intronic
910764969 1:90772647-90772669 CCATGTCCTTTTTAGGGACATGG + Intergenic
911402849 1:97398251-97398273 TCCTGTCATTTTTAGGGACATGG - Intronic
911875920 1:103163080-103163102 TAGTGTCATTTACAGGGACATGG - Intergenic
912100282 1:106195059-106195081 GGGTGTCATTTTATGTGACATGG - Intergenic
914807887 1:151005082-151005104 AAGTGTCATTTAAGGGGAGAAGG - Intronic
915725563 1:158014613-158014635 CAGTGTCGGTCTAAGGGACTGGG - Intronic
915868904 1:159536783-159536805 CACTGTCATTATAAAGGACTGGG + Intergenic
918136524 1:181679112-181679134 CAGAGTCATTTTAATAGATAGGG + Intronic
920981370 1:210839245-210839267 TAGTGTCCTTTGCAGGGACATGG + Intronic
921434277 1:215099319-215099341 TCGTGTCCTTTTCAGGGACATGG - Intronic
922008908 1:221561295-221561317 CAGTGTCATTTTATTTTACATGG + Intergenic
923028902 1:230231041-230231063 CACTGTCAGTTAAAGGGACAAGG - Intronic
923193611 1:231643294-231643316 CAGTGAGATCTGAAGGGACAAGG - Intronic
924875995 1:248105241-248105263 TAATGTCTTTTTCAGGGACATGG - Intergenic
924900807 1:248397075-248397097 CAATGTCCTTTGCAGGGACATGG + Intergenic
1063569735 10:7204022-7204044 CTGCATCATTTTAAGAGACAGGG + Intronic
1063985416 10:11496525-11496547 TAGTGGCATTTCAAGGGAAAGGG + Intronic
1064236509 10:13580963-13580985 CAGTGGTATTTTTTGGGACAGGG + Intergenic
1064555703 10:16545286-16545308 CAGTGTTGTGTTAAGGGAAAGGG + Intergenic
1066521484 10:36224889-36224911 AAGTGTAATCTTAAGTGACAGGG - Intergenic
1067177477 10:43960188-43960210 AAGGGTCATTTCAATGGACAGGG + Intergenic
1067702900 10:48586548-48586570 TAGTGACATTTAAAGGGCCAGGG - Intronic
1070369335 10:75766948-75766970 TAATGTCCTTTTAAGGGACATGG - Intronic
1071991725 10:91106091-91106113 CAGTGTCAGTTGCAGGGACATGG - Intergenic
1072507407 10:96082419-96082441 CATTGTCACTTGAAGTGACAGGG - Intergenic
1073517611 10:104091298-104091320 CAGTGTCATTCTGAGGGTGAGGG + Intergenic
1074369628 10:112889503-112889525 CACTGTCTTTTTTAGAGACAAGG - Intergenic
1075047872 10:119160170-119160192 TATTGTCATTTTTAGAGACAGGG - Intronic
1075309427 10:121400328-121400350 TCGTGTCATTTGTAGGGACATGG - Intergenic
1076095269 10:127729552-127729574 TAGTGTCTTTTGCAGGGACATGG - Intergenic
1076349743 10:129807835-129807857 TAGGGTCATTTTGAGGAACAAGG + Intergenic
1076582507 10:131521036-131521058 TAGTGTCCTTTGCAGGGACATGG - Intergenic
1077051865 11:570242-570264 CAGTGTCCTTATAAAAGACAGGG + Intergenic
1078136800 11:8658440-8658462 CACTGTCATTTTGGGGAACATGG - Intronic
1078620187 11:12900065-12900087 AAGTGCCTTTTTAAGAGACAAGG + Intronic
1079787610 11:24694757-24694779 TCGTGTCCTTTTCAGGGACATGG + Intronic
1079879503 11:25907297-25907319 CCTTGTCCTTTTCAGGGACATGG + Intergenic
1081040541 11:38205115-38205137 TCATGTCATTTTCAGGGACATGG + Intergenic
1083526222 11:63368115-63368137 TCGTGTCATTTGTAGGGACATGG + Intronic
1084840895 11:71846364-71846386 CCATGTCATTTGCAGGGACATGG - Intergenic
1086607929 11:88719368-88719390 CTGTGTCCTTTGCAGGGACATGG - Intronic
1086920941 11:92585945-92585967 CAGTCTCATGTGAAGGGAGAAGG + Intronic
1087366654 11:97228295-97228317 GAGTGTCTTTTTAAAGGAGAAGG - Intergenic
1087445935 11:98253427-98253449 CTGTGTCCTTTGCAGGGACATGG - Intergenic
1087681541 11:101224196-101224218 CAGGGTCATTTTTACGCACATGG + Intergenic
1089938367 11:122389116-122389138 CAATGTCCTTTGCAGGGACATGG - Intergenic
1092335961 12:7634008-7634030 TCATGTCATTTTCAGGGACATGG + Intergenic
1092697744 12:11192153-11192175 CTGTGTCATCTTATGGGAGAAGG + Intergenic
1093283530 12:17227749-17227771 TCGTGTCCTTTGAAGGGACATGG - Intergenic
1093804732 12:23418050-23418072 CAGTGTCCTTTGTAGGGACATGG - Intergenic
1093898547 12:24604214-24604236 AAGTGTCTTTTAAATGGACATGG + Intergenic
1094197875 12:27767983-27768005 CAGTGTCATTTAAAGAGGCAGGG + Intronic
1094247300 12:28313611-28313633 CAGTGTTATTTTATGTGATATGG + Intronic
1094598280 12:31885129-31885151 CAATGTCCTTTGCAGGGACATGG + Intergenic
1095605457 12:44062076-44062098 CAGTATCATTTTGAGGGATGAGG + Intronic
1096641199 12:52995720-52995742 CTGTGTTTTTTTAAGAGACAAGG - Intergenic
1096861356 12:54530967-54530989 AAGTGTCATATAAAGGAACACGG + Intronic
1096950617 12:55465138-55465160 TAGTGTCCTTTGCAGGGACATGG + Intergenic
1097599185 12:61670652-61670674 CTGTGGCTTTTTCAGGGACATGG + Intergenic
1097762834 12:63488424-63488446 TAATGTCCTTTTTAGGGACATGG - Intergenic
1098789643 12:74805523-74805545 TCATGTCATTTTCAGGGACATGG + Intergenic
1098997439 12:77136885-77136907 TAGTGTCCTTTGTAGGGACATGG + Intergenic
1099549619 12:84026731-84026753 TAATGTCATTTGCAGGGACATGG + Intergenic
1101547678 12:105731929-105731951 CACTGTCATTTAAAGAAACAAGG + Intergenic
1101905249 12:108819916-108819938 CTTTTTCATTTTAAGGGAGAAGG + Intronic
1102624770 12:114226272-114226294 CAGAGTCATTTTATGGCAAATGG + Intergenic
1103418125 12:120758361-120758383 CAGTGTCATTCTAAGCCACTTGG - Intergenic
1103743998 12:123109962-123109984 TAGTGTCTTTTTAAGAGACGGGG + Intronic
1104100511 12:125604282-125604304 CTGTGTCCTTTTCAGGGACATGG + Intronic
1104171359 12:126284717-126284739 CCATGTCACTTTAAAGGACATGG - Intergenic
1104255863 12:127137573-127137595 TCGTGTCCTTTGAAGGGACATGG - Intergenic
1104338215 12:127921094-127921116 AAATGTCCTTTTCAGGGACACGG + Intergenic
1106695365 13:32166938-32166960 CACTGTCATTTTAAGAGACATGG + Intronic
1106796405 13:33210073-33210095 CAGTGTTCTTTGAAGGGGCAAGG + Intronic
1106920866 13:34561871-34561893 CAGTGTCTTTATAAGAGAGAAGG + Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107520596 13:41176815-41176837 CAGTCTTATTTTTAGAGACAGGG + Intergenic
1107577290 13:41740157-41740179 CAGTGTCATTTTAATGGCAGAGG + Intronic
1109662637 13:65484431-65484453 TAATGTCCTTTTCAGGGACATGG - Intergenic
1110052925 13:70926708-70926730 TTGTGTCCTTTTCAGGGACATGG + Intergenic
1111329871 13:86751239-86751261 TCATGTCATTTTCAGGGACATGG - Intergenic
1111544147 13:89708180-89708202 CAGTTTCATTTTTACTGACAAGG + Intergenic
1111704533 13:91731836-91731858 CCGTGTCCTTTTCAGGGACATGG - Intronic
1112914677 13:104533468-104533490 CAGTTTCAATTTGAGGGAAAGGG + Intergenic
1113321034 13:109232363-109232385 TGGTATCATGTTAAGGGACATGG - Intergenic
1114742826 14:25115789-25115811 TAGTGTCCTTTGCAGGGACATGG + Intergenic
1115788333 14:36851473-36851495 CTTTGTCATTTTAAGGAGCAGGG + Intronic
1116148162 14:41101480-41101502 GTATGTCTTTTTAAGGGACATGG - Intergenic
1116396507 14:44453339-44453361 CAGAGTCATATAATGGGACAGGG - Intergenic
1116484408 14:45429987-45430009 CCATGTCATTTGCAGGGACATGG - Intergenic
1116538131 14:46062041-46062063 CAGTCACATTTTAAGGTACTTGG + Intergenic
1118490819 14:66257890-66257912 CAATGTCCTTTGCAGGGACATGG - Intergenic
1119006030 14:70930139-70930161 TTGTGTGTTTTTAAGGGACAGGG + Intronic
1119246668 14:73115480-73115502 TAGTGTCCTTTACAGGGACATGG - Intronic
1119757999 14:77132290-77132312 CAGTGTCATTGTCAGTGGCAGGG - Exonic
1122087628 14:99318489-99318511 CAGTGACATTTTAAGCTACAAGG - Intergenic
1122909539 14:104820540-104820562 CAGTCACATTTTGAGGGATAGGG + Intergenic
1123221062 14:106856182-106856204 TCATGTCATTTTCAGGGACATGG - Intergenic
1123850927 15:24355805-24355827 CATTGTCATGCTAAGGTACAAGG - Intergenic
1125368748 15:38947447-38947469 AAGTGTTATCTTAAGGGAAATGG - Intergenic
1127616399 15:60690326-60690348 CAGCTTCCTTTTAAGTGACATGG - Intronic
1130035055 15:80351696-80351718 CAATGACATTCTATGGGACATGG + Intronic
1130041294 15:80406924-80406946 GGGTTTAATTTTAAGGGACATGG + Intronic
1133973419 16:10582846-10582868 CACTGTTTTTTTAAGAGACAGGG - Intergenic
1134197865 16:12172752-12172774 CATTCTCGATTTAAGGGACATGG + Intronic
1134305942 16:13032329-13032351 TCGTGTCCTTTTCAGGGACATGG - Intronic
1135634469 16:24062274-24062296 CAGTGTCAGCTGGAGGGACAGGG + Intronic
1137232115 16:46576343-46576365 CAGTCATATTTTAAGGCACATGG - Intergenic
1137371984 16:47915680-47915702 TAATGTCATTTGTAGGGACACGG + Intergenic
1137799511 16:51249211-51249233 CAATGTCCTTTGTAGGGACATGG - Intergenic
1138080748 16:54088770-54088792 CAGTGGTAGTTCAAGGGACATGG - Intronic
1138740098 16:59298069-59298091 CAGTGTTATTTTAAGGATAAAGG + Intergenic
1138847637 16:60585968-60585990 TCGTGTCCTTTTTAGGGACATGG + Intergenic
1139110008 16:63878639-63878661 CACTGTCATTTGCAGAGACATGG + Intergenic
1140669597 16:77264087-77264109 TAATGTCATTTGCAGGGACATGG - Intronic
1141415547 16:83869697-83869719 TTGTGTCCTTTTCAGGGACATGG + Intergenic
1142065395 16:88059515-88059537 GAGTTGCTTTTTAAGGGACACGG + Intronic
1142190680 16:88715970-88715992 CATGGTCATTTTCAGTGACAAGG - Exonic
1143722940 17:8826464-8826486 TAATGTCCTTTTCAGGGACATGG + Intronic
1146108960 17:30069757-30069779 CAGAGCCATTTTAAGAGAAAGGG + Intronic
1146738185 17:35257656-35257678 CAGGGGCATTTTCAGTGACAAGG - Intronic
1146776116 17:35618610-35618632 GAAAATCATTTTAAGGGACAGGG + Intronic
1146874705 17:36399311-36399333 TCATGTCATTTTCAGGGACATGG - Intronic
1147064678 17:37913570-37913592 TCATGTCATTTTCAGGGACATGG + Intergenic
1147304867 17:39556332-39556354 CAGTGGCATTCTCAGGGTCAGGG - Intronic
1148949185 17:51294504-51294526 CCATGTCCTTTTTAGGGACATGG - Intronic
1151024846 17:70666354-70666376 CAATGTCCTTTGCAGGGACATGG + Intergenic
1152030182 17:77837506-77837528 CAGTCACATTTTGAGGGACTGGG + Intergenic
1152486202 17:80595437-80595459 CAGTGTCATCTTAGCAGACAGGG + Intronic
1152647545 17:81476492-81476514 CCATGTCATTTTCATGGACAAGG - Intergenic
1153933930 18:9903834-9903856 TTGTGTCCTTTTCAGGGACATGG + Intergenic
1155350287 18:24899608-24899630 CCATGTCCTTTTCAGGGACATGG + Intergenic
1155979883 18:32168919-32168941 CAGTGGGATCTTAAAGGACAGGG + Intronic
1156685705 18:39642915-39642937 CAGTGCTATTGTAAGGGAAAAGG + Intergenic
1157630424 18:49089878-49089900 CAGAGTCATTTTGCAGGACAAGG - Intronic
1158936602 18:62370277-62370299 AACTGTCATTTGAAGGGTCAGGG + Intronic
1160108193 18:75999367-75999389 TCATGTCATTTTCAGGGACATGG - Intergenic
1161882045 19:6962372-6962394 CAATGTCCTTTGTAGGGACATGG + Intergenic
1162150925 19:8645139-8645161 CTGTTTTATTTTAAGAGACAGGG + Intergenic
1162226516 19:9227200-9227222 CAATGTCCTTTGTAGGGACATGG - Intergenic
1162584093 19:11548533-11548555 CATTTTCATTTTTAGAGACAGGG - Intronic
1163101450 19:15099575-15099597 CAGTCACATTCTAAGGGACCGGG + Intergenic
1163957433 19:20657462-20657484 CAGTGTTATTGCAAAGGACATGG - Intronic
1164669297 19:30063618-30063640 CTCTGTCATTTTTAGGGACTGGG + Intergenic
1166463869 19:43015425-43015447 CTGTGTCCCTTTAAGAGACAAGG - Intronic
1167565946 19:50257239-50257261 CAGGGTCAGTTTTAGGGACCTGG - Intronic
927736937 2:25532675-25532697 CAGTGTTATTTTAGGGGAATTGG - Intronic
928242187 2:29596285-29596307 CAGAGTCATTTTCACAGACAGGG - Intronic
929336107 2:40748030-40748052 CAATGTCATATTAAGGAACTTGG + Intergenic
929344379 2:40863285-40863307 TCATGTCATTTTCAGGGACATGG + Intergenic
929409349 2:41679255-41679277 CTCTGTATTTTTAAGGGACAGGG + Intergenic
929464151 2:42129692-42129714 CAGTGTCATGTCAAGGGAAGAGG - Intergenic
930425634 2:51209149-51209171 CAGTGGAATTTTAACTGACAAGG + Intergenic
930502993 2:52246506-52246528 CAGTGTCATATTATTGGCCAAGG - Intergenic
931090526 2:58881142-58881164 GAATATCATTGTAAGGGACAGGG - Intergenic
931979755 2:67681978-67682000 CATTGTCATGTGAAGGGACATGG - Intergenic
933185419 2:79273020-79273042 CAGTGCCATATCAAGGTACATGG + Intronic
933459040 2:82555781-82555803 CACTGTGATTATAAGGGAGAAGG + Intergenic
933819910 2:86101416-86101438 CAGTGTCACTCTAAGGGCCAAGG + Intronic
934039156 2:88113642-88113664 CAGTGTCATTTCTAAGAACATGG + Intergenic
934907758 2:98220806-98220828 TCGTGTCCTTTTCAGGGACATGG + Intronic
937007578 2:118531307-118531329 CAGGGTCCTATTAAGGGTCACGG + Intergenic
937195962 2:120156539-120156561 CAGTGGCAGTTGATGGGACACGG - Intronic
937580834 2:123485589-123485611 CAGTGTTATTCTCAGAGACATGG - Intergenic
939568043 2:143807965-143807987 CAGTGTCATTTGAGGGGAATAGG + Intergenic
939730251 2:145775783-145775805 CAGTTTTATTTTATGTGACATGG + Intergenic
940593507 2:155761068-155761090 TAATGTCCTTTGAAGGGACATGG + Intergenic
940896359 2:159084996-159085018 CAGTGTCATTTTAAATGGAATGG + Intronic
942754315 2:179321208-179321230 TAGTGTCCTTTGTAGGGACATGG + Intergenic
943386962 2:187213192-187213214 CCATGTCCTTTTCAGGGACATGG + Intergenic
944438863 2:199721425-199721447 CTATGTCCTTTGAAGGGACATGG - Intergenic
944502737 2:200378562-200378584 CAGTGACATTTCAAGGAACTAGG + Intronic
944913991 2:204338883-204338905 CAGTGGCAATCTAAGGGAGAGGG - Intergenic
945349984 2:208765968-208765990 TAGTGTCCTTTGCAGGGACATGG + Intronic
945392444 2:209280325-209280347 GATGGCCATTTTAAGGGACATGG + Intergenic
945779431 2:214150878-214150900 CAGTGTGATTTTAAGGCCCTTGG + Intronic
946013476 2:216585103-216585125 CAGTGACATTCTAAGGTACTGGG - Intergenic
946478430 2:220031076-220031098 CAGTTTCATATTCAGGGACTAGG - Intergenic
947234269 2:227923369-227923391 AAGTGTCATTTTGTGGGATATGG + Intronic
947303507 2:228716629-228716651 CTGTGTCCTTTGTAGGGACATGG + Intergenic
947384644 2:229578748-229578770 AACTTTCATTTTAAAGGACAAGG + Intronic
1170228432 20:14019024-14019046 CAGAGTTAATTTAAGGGTCAAGG - Intronic
1170476566 20:16720783-16720805 CCGTGTCCTTTGCAGGGACATGG - Intergenic
1176691535 21:9916623-9916645 CTGTGTCCTTTGCAGGGACATGG - Intergenic
1176975581 21:15317010-15317032 CTGTGTCCTTTGCAGGGACATGG - Intergenic
1177148687 21:17432979-17433001 CAGTCACATTTTAAGGTACTTGG - Intergenic
1177449023 21:21240725-21240747 CAGTGTCATTTTAAGGGACAAGG - Intronic
1177778529 21:25596943-25596965 CAGTGTCATTTTAAGTGTGGAGG + Intronic
1179103000 21:38373078-38373100 CAGTGTCAAGTAAAGGTACAGGG + Intergenic
1179127982 21:38609026-38609048 CAGTGTCTTTCTTGGGGACAAGG + Intronic
1179153996 21:38833701-38833723 CAGTGTCATTTTGAGGTTCTGGG + Intergenic
1179402298 21:41095473-41095495 CTGTGACATTTTGAGGGACTGGG + Intergenic
1180353403 22:11821511-11821533 CAGTGTCATTGCAAGGAACGAGG - Intergenic
1180384836 22:12170846-12170868 CAGTGTCATTGCAAGGAACGAGG + Intergenic
1182984589 22:34704628-34704650 CAATGTCCTTTTGAGGGATAGGG - Intergenic
1182995172 22:34805496-34805518 TCATGTCATTTTCAGGGACATGG - Intergenic
1183530526 22:38351118-38351140 CAGGGCCATTGTGAGGGACAGGG - Intronic
1184995822 22:48206725-48206747 CAATGTCAGTTAAAGGGTCAGGG + Intergenic
1185188008 22:49414538-49414560 CACTTTTATTTTAAGAGACAGGG + Intronic
1203324646 22_KI270738v1_random:2370-2392 TTGAGTCTTTTTAAGGGACAGGG + Intergenic
949786890 3:7751779-7751801 TCGTGTCCTTTTCAGGGACATGG + Intergenic
951365282 3:21774105-21774127 TAATGTCCTTTTCAGGGACATGG + Intronic
952550060 3:34466625-34466647 CCATGTCCTTTGAAGGGACATGG - Intergenic
952692616 3:36227545-36227567 CCATGTCATTTATAGGGACATGG + Intergenic
953659616 3:44882638-44882660 AAGTGTCCTTATAAGAGACATGG - Intronic
956145806 3:66189481-66189503 CAGAATCATTATAAGGGTCAGGG - Intronic
956549784 3:70445315-70445337 TCGTGTCCTTTTTAGGGACATGG - Intergenic
957171749 3:76746138-76746160 TCATGTCATTTTTAGGGACATGG - Intronic
957381154 3:79431451-79431473 TAGTGTTATTTTAGGGGAAAGGG - Intronic
959147595 3:102567747-102567769 CCGTGTCCTTTGCAGGGACATGG + Intergenic
959433963 3:106289950-106289972 CAATGCCACATTAAGGGACATGG + Intergenic
959619720 3:108386790-108386812 TAGTATCATTTTTAGGGATAAGG - Intronic
959779529 3:110212205-110212227 CACTGTCCTGTTGAGGGACAGGG - Intergenic
960210125 3:114954632-114954654 CAGTGTGAGTTTAAGTGTCAGGG + Intronic
960410992 3:117324360-117324382 AAGGGTCATTTTCAGGGAAATGG - Intergenic
960414225 3:117364547-117364569 TCGTGTCTTTTTCAGGGACATGG + Intergenic
960483521 3:118223031-118223053 CAGTGTCATTGAAATGGAAAAGG + Intergenic
961652481 3:128423706-128423728 CAGTTTCTTTTCAGGGGACAGGG + Intergenic
962152765 3:132910504-132910526 CAGTCTCAGTCTAAGGGAGATGG + Intergenic
964958446 3:162392433-162392455 AAGTGTAATTTTAAGGGGTAGGG - Intergenic
965038289 3:163471143-163471165 TCGTGTCCTTTTTAGGGACATGG - Intergenic
965980999 3:174690609-174690631 CAATGCCATTTTAATGGAAATGG + Intronic
966285922 3:178295413-178295435 CAATTTCAGTTTAAGGGACCAGG + Intergenic
966295042 3:178409769-178409791 ATGTGCCATTTTATGGGACAAGG + Intergenic
966626647 3:182024095-182024117 AAGTGTCATTATAAGAGTCATGG - Intergenic
967630116 3:191735903-191735925 TAGTGTCTTTTGTAGGGACATGG + Intergenic
969783804 4:9435412-9435434 CTGTGTCCTTTGTAGGGACATGG - Intergenic
970727740 4:19066434-19066456 TCGTGTCCTTTTCAGGGACATGG + Intergenic
971870430 4:32229472-32229494 AAATGACATTTTAAAGGACAGGG - Intergenic
972085718 4:35211965-35211987 TAGTGTCATTTTAAAGCAGATGG - Intergenic
972417273 4:38853619-38853641 CACTTTCTTTTTAAGAGACAGGG + Intronic
972555970 4:40181537-40181559 CAATGTCATCTTCAGGGACTTGG + Intergenic
973058085 4:45685834-45685856 TCATGTCATTTTCAGGGACATGG + Intergenic
974224901 4:59028050-59028072 TAATGTCCTTTTCAGGGACAGGG + Intergenic
974901666 4:68006896-68006918 TAGTGTCCTTTGCAGGGACATGG + Intergenic
976525220 4:86079246-86079268 TAGTGTTATAATAAGGGACATGG + Intronic
978848316 4:113302144-113302166 CAGTGTAAGGTTAAGAGACAAGG - Intronic
979373785 4:119920308-119920330 CCGTGTCCTTTGCAGGGACATGG + Intergenic
979853712 4:125605835-125605857 TAATGTCTTTTTCAGGGACATGG - Intergenic
980372872 4:131901251-131901273 CATTGTCATTTTCAGGAGCAAGG + Intergenic
980808837 4:137849218-137849240 TAGTGTCCTTTGTAGGGACATGG + Intergenic
981636671 4:146889023-146889045 AAATGTCATTTTAAGTAACAAGG + Intronic
983172703 4:164553797-164553819 TAATGTCCTTTTTAGGGACATGG - Intergenic
983188813 4:164732489-164732511 CAGTTTCTTTTTAAGTGAAACGG - Intergenic
983423162 4:167546796-167546818 CCATGTCCTTTGAAGGGACATGG - Intergenic
983985900 4:174060489-174060511 CAGTGCTTTTTTAAGGCACAAGG + Intergenic
984607615 4:181803757-181803779 CATTTTTAATTTAAGGGACAAGG - Intergenic
984709435 4:182872938-182872960 CAGCTTCATTTTAAGTGACTAGG - Intergenic
986018192 5:3776095-3776117 AAGTGTCATTTTAAGGGAGTGGG - Intergenic
986380176 5:7176382-7176404 CCATGTCCTTTTTAGGGACATGG + Intergenic
987290512 5:16504209-16504231 CTGTGTCCTTTGCAGGGACATGG - Intronic
988379731 5:30484682-30484704 TAATGTCATTTGCAGGGACATGG - Intergenic
988418044 5:30970948-30970970 GAGTGTCATATTAAGGGTCAAGG - Intergenic
990023199 5:51154414-51154436 CAATGTCATTTGAAGCCACATGG + Intergenic
990405834 5:55489929-55489951 CATTGTCATTTTATGTGACTTGG - Intronic
990648650 5:57873163-57873185 AAGTGTCATTTTCCTGGACAAGG - Intergenic
990725020 5:58743718-58743740 CTGTGTCCTTTGCAGGGACATGG - Intronic
992806687 5:80344753-80344775 CAGTGTCCTTTTAAGGTCAAGGG - Intergenic
993555532 5:89331892-89331914 TCATGTCATTTTCAGGGACATGG - Intergenic
994512702 5:100725514-100725536 GAGTGTCATTATACGGGGCATGG - Intergenic
994708196 5:103231790-103231812 CAGTCTCATTTTGAGGTACTAGG - Intergenic
996854277 5:127987635-127987657 CAGTGTCCTATTAGGGGAAAGGG + Intergenic
997050315 5:130372638-130372660 CAGGGTCATTATAAGGAACGAGG + Intergenic
998704178 5:144739801-144739823 TAGTGTCCTTTTCAGGGACATGG + Intergenic
999523215 5:152374286-152374308 GTGTGTCACCTTAAGGGACATGG + Intergenic
1000367294 5:160503646-160503668 GAGTCTCATCTTAAGAGACAAGG - Intergenic
1002843278 6:924147-924169 CCGTATCATTTAAAGGGACCAGG - Intergenic
1002946020 6:1761925-1761947 CTGTTTCATTTTTAGGGAAAGGG - Intronic
1003342668 6:5236946-5236968 GATTGTCTTTTTAAGAGACAGGG - Intronic
1003704903 6:8514397-8514419 ATGTGTCATTTTAAGATACAAGG - Intergenic
1003999007 6:11575868-11575890 CAGTGTTATGTTAAGTTACAGGG + Exonic
1004982945 6:21046648-21046670 CAGTGTCATAAAAAGTGACAGGG + Intronic
1005052538 6:21698132-21698154 CAGTTTCATTCTAAGGTACTGGG + Intergenic
1006198804 6:32267240-32267262 CAGAGTCATTTTAAGGGATGAGG + Intergenic
1006334636 6:33414194-33414216 CAGAGGCATTTTAAGAGCCAGGG - Intronic
1007023735 6:38548494-38548516 CATTTTCATTTTAAAGGAAAAGG - Intronic
1007173630 6:39881908-39881930 CAGTTTCCTTTTATGTGACATGG + Intronic
1007402021 6:41608187-41608209 CAGTGTATTTTTAAGGAGCATGG + Intergenic
1008306453 6:49907561-49907583 AACAGTCATTTTCAGGGACAAGG - Intergenic
1010312393 6:74402540-74402562 TCATGTCATTTTTAGGGACATGG + Intergenic
1010377030 6:75182516-75182538 TTGTGTCCTTTTCAGGGACATGG - Intronic
1010636737 6:78268801-78268823 TAGTGTCCTTATAAGGGCCAAGG + Intergenic
1010656218 6:78514612-78514634 CAGTCTCATTTTCAGGCACTTGG + Intergenic
1011314564 6:86017158-86017180 CAATGTCATATTAAGGGTAAGGG + Intergenic
1011327897 6:86171355-86171377 TCGTGTCCTTTGAAGGGACATGG + Intergenic
1012063572 6:94517388-94517410 CCATGTCCTTTGAAGGGACATGG + Intergenic
1012210443 6:96511521-96511543 CAGTCACATTTTAAGGTACAGGG + Intergenic
1013345214 6:109253502-109253524 CAGTTTCATTTTCAGGGCCCAGG - Intergenic
1014234324 6:118937945-118937967 AAGTGACATTTAAAGGGACTGGG - Intergenic
1014279955 6:119431166-119431188 CAGTGGCATTTCAAGGATCATGG - Intergenic
1014671363 6:124308296-124308318 TAATGTCCTTTTCAGGGACATGG - Intronic
1014683721 6:124468281-124468303 CATTGACATTTTAACGGACCTGG - Intronic
1014894300 6:126883072-126883094 TAATGTCCTTTTCAGGGACATGG - Intergenic
1015726938 6:136308754-136308776 CTCTGTCCTTTTAAGAGACAGGG - Intergenic
1016120765 6:140339220-140339242 TATTGTCCTTTTCAGGGACATGG - Intergenic
1016863175 6:148742124-148742146 CTGTCTAATTGTAAGGGACAGGG - Intergenic
1017045386 6:150342623-150342645 CAATGTCATTTTTAGGAAAAGGG - Intergenic
1019133377 6:169893453-169893475 CAGTGTCCTTCTGAGGGACTTGG + Intergenic
1020498419 7:8886239-8886261 CAGTGTGATTCAAAGGAACATGG - Intergenic
1022052137 7:26686741-26686763 CAGTGTCAGTTTAAAAGTCAGGG + Intronic
1022847938 7:34229855-34229877 TAATGTCTTTTTCAGGGACATGG - Intergenic
1024314841 7:48006234-48006256 GAGTGTCATTTTCAGGAATACGG + Intronic
1025553019 7:62273128-62273150 CTGAGTCTTTTTAAGGGCCAGGG + Intergenic
1026539088 7:71264662-71264684 TCGTGTCATTTGCAGGGACATGG + Intronic
1030380816 7:108809891-108809913 CAGTGAGATTTTAAGAGAGAGGG + Intergenic
1030875034 7:114803378-114803400 CATGGTCCTTTTAATGGACAAGG - Intergenic
1032901613 7:136315832-136315854 TAATGTCCTTTTCAGGGACATGG - Intergenic
1032969215 7:137139453-137139475 CATTGTCCTTTGTAGGGACATGG + Intergenic
1033618095 7:143036745-143036767 CCATGTCATTTGCAGGGACATGG + Intergenic
1034315023 7:150122923-150122945 TCGTGTCCTTTTCAGGGACATGG + Intergenic
1034791873 7:153977859-153977881 TCGTGTCCTTTTCAGGGACATGG - Intronic
1035711791 8:1722770-1722792 TAATGTCATTTGCAGGGACAGGG + Intergenic
1035840834 8:2810551-2810573 AACTTTCATTTGAAGGGACATGG + Intergenic
1036062639 8:5341322-5341344 TCGTGTCCTTTTTAGGGACATGG - Intergenic
1037007465 8:13799813-13799835 CAGTTTTATTTTAAGAGCCACGG - Intergenic
1039508916 8:38073155-38073177 CAGGGTCATTTTAAGTGCCGAGG - Intergenic
1041155494 8:54981512-54981534 CCATGTCCTTTTCAGGGACATGG + Intergenic
1042362639 8:67900089-67900111 CATTGTCCTTTGTAGGGACATGG + Intergenic
1043705376 8:83342277-83342299 TAGTGTCCTTTGTAGGGACATGG + Intergenic
1043741516 8:83818800-83818822 CAGCTTCATTTTCAGGCACAAGG + Intergenic
1044600657 8:94000759-94000781 CTCTGTCTTTTTAAGAGACAGGG + Intergenic
1046906889 8:119583069-119583091 CAGTGGCACTTCAGGGGACAGGG - Intronic
1047051544 8:121118378-121118400 CAATGTCCTTTGGAGGGACATGG + Intergenic
1047327986 8:123858147-123858169 AAGTGTCATTTAAAGGAACCTGG - Intronic
1047541808 8:125774806-125774828 CTGTGTCCTTTTCAGGCACATGG - Intergenic
1047660861 8:127035175-127035197 TAGTGGCAGTTTTAGGGACATGG + Intergenic
1047692797 8:127373384-127373406 CATTGTCCTTTGCAGGGACATGG - Intergenic
1047909475 8:129511877-129511899 CAAAGTGATTTTAAGGGAGAAGG - Intergenic
1048551377 8:135436596-135436618 TAGCCTCATTTTAGGGGACAGGG + Intergenic
1051914381 9:22190808-22190830 TCATGTCATTTTTAGGGACATGG + Intergenic
1054331370 9:63759935-63759957 CAATGTCCTTTGTAGGGACATGG + Intergenic
1054719700 9:68592629-68592651 CATTGTCCTTTGTAGGGACATGG - Intergenic
1055234176 9:74099663-74099685 CAGAGTCATTTTTTGGGAGACGG - Intergenic
1055849512 9:80609502-80609524 TCGTGTCCTTTTTAGGGACATGG - Intergenic
1055992169 9:82118562-82118584 TGGTGTGATTTTAAGGTACATGG + Intergenic
1056818620 9:89820668-89820690 TTCTGTCATTTTAAGGGATATGG + Intergenic
1057348481 9:94274236-94274258 CAGTGACATTCTAAGGTACTAGG + Intronic
1059450027 9:114365023-114365045 CAGTGTCAAATCAAGGTACAGGG + Intronic
1059961553 9:119569992-119570014 CCATGTCCTTTTCAGGGACATGG - Intergenic
1060898213 9:127233213-127233235 TATTGTTATTTTAAGAGACAGGG - Intronic
1186044771 X:5523458-5523480 CATTTTCATTTAAAGGGAAAAGG + Intergenic
1186695042 X:12021467-12021489 CAATATCATTTAAAGGAACAAGG + Intergenic
1186867115 X:13731739-13731761 CCGTGTCAATTTATGGCACAGGG + Intronic
1187053162 X:15714308-15714330 CAGTCACATTTTAAGGTACTGGG + Intronic
1187840835 X:23485833-23485855 TTGTGTCATTTACAGGGACATGG + Intergenic
1189094580 X:38124755-38124777 GATTGTCACTTTGAGGGACAGGG + Intronic
1189429350 X:40933161-40933183 CAGTGCCATCTGAAGGGAAAGGG - Intergenic
1189894391 X:45639104-45639126 CCGTGTCCTTTGCAGGGACATGG + Intergenic
1190653856 X:52593979-52594001 CACTGTCATTCTATGGGACTAGG - Intergenic
1190965599 X:55297959-55297981 TCATGTCATTTTTAGGGACATGG - Intergenic
1190983754 X:55482185-55482207 CACTGTCATTTCAAAGGAAAAGG - Intergenic
1191094159 X:56657273-56657295 TAATGTCCTTTTCAGGGACATGG - Intergenic
1191113213 X:56824435-56824457 CATTGTCCTTTGTAGGGACATGG + Intergenic
1191141885 X:57123307-57123329 CCGTGTCCTTTGTAGGGACATGG - Intergenic
1191756797 X:64601753-64601775 TAATGTCCTTTTCAGGGACATGG - Intergenic
1192331413 X:70178201-70178223 AAGAGTCATATTCAGGGACAGGG + Intronic
1193011297 X:76677679-76677701 TAATGTCCTTTTTAGGGACATGG + Intergenic
1193182739 X:78478000-78478022 TCATGTCCTTTTAAGGGACATGG - Intergenic
1193985431 X:88235532-88235554 TAATGTCCTTTTCAGGGACATGG - Intergenic
1194069181 X:89298330-89298352 TCGTGTCATTTGTAGGGACATGG + Intergenic
1194744996 X:97618507-97618529 CAGTGTCTTTGCAAGGGTCAGGG - Intergenic
1195833238 X:109083637-109083659 TAGTGTCCTTTGCAGGGACACGG - Intergenic
1195958844 X:110364219-110364241 AAGTGTCCTTATAAGTGACAGGG - Intronic
1197063456 X:122211233-122211255 CAATGACATATTAAGGGAAACGG - Intergenic
1201453663 Y:14144533-14144555 TAATGTCCTTTTAAGGGAAAAGG + Intergenic
1201855473 Y:18536025-18536047 CAGTGTCATGTTTAGGGTTATGG + Intergenic
1201877848 Y:18784360-18784382 CAGTGTCATGTTTAGGGTTATGG - Intronic
1202595021 Y:26529542-26529564 TAATGTCCTTTTTAGGGACATGG - Intergenic