ID: 1177453998

View in Genome Browser
Species Human (GRCh38)
Location 21:21311106-21311128
Sequence CTACACAAACATATCAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177453995_1177453998 7 Left 1177453995 21:21311076-21311098 CCTTCCATTGAAAGTTTCACAAC 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1177453998 21:21311106-21311128 CTACACAAACATATCAAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 127
1177453996_1177453998 3 Left 1177453996 21:21311080-21311102 CCATTGAAAGTTTCACAACAATT 0: 1
1: 0
2: 1
3: 31
4: 304
Right 1177453998 21:21311106-21311128 CTACACAAACATATCAAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177453998 Original CRISPR CTACACAAACATATCAAGCT GGG Intronic
903073819 1:20745760-20745782 CTTCCCAAAAATGTCAAGCTAGG + Intronic
911465465 1:98247287-98247309 CTACACAAAGAAATGAAGATTGG - Intergenic
918248298 1:182679836-182679858 CTACACACACATATAAACCTTGG + Intronic
1063572778 10:7231481-7231503 CTACACAAAGACATTAAGCTGGG + Intronic
1064846816 10:19664766-19664788 ATACACAAACATATTAATTTTGG - Intronic
1072133877 10:92524625-92524647 CAACATAAACAAATCAGGCTGGG + Intronic
1074674919 10:115837210-115837232 CTACACAAATATATTTAGTTTGG + Intronic
1078617400 11:12878754-12878776 GTACACAAACATATAATACTTGG - Intronic
1081567283 11:44267748-44267770 CCACACATAAATATCAACCTTGG + Intronic
1097852477 12:64426493-64426515 GTACACACAGATATGAAGCTGGG + Intronic
1097919974 12:65061402-65061424 CTCAACAAACATATCAAGAAAGG + Intronic
1099090160 12:78296637-78296659 CAACATATACATATCAAGATAGG - Intergenic
1106211767 13:27655254-27655276 ATACACAAACATATAATTCTTGG + Intronic
1107566253 13:41608066-41608088 ACACACAAACATATCAAGGAAGG + Intronic
1107575310 13:41712957-41712979 CAACATAAACATATCAAGTGAGG - Intronic
1109993007 13:70083579-70083601 CTACAAAAAGATATCAAACAGGG + Intronic
1111910603 13:94307475-94307497 CTACAAAAAAATAAAAAGCTGGG - Intronic
1112537648 13:100275548-100275570 CAAGACAAACATATCAAACTGGG - Intronic
1112883774 13:104143427-104143449 AAACATAAAAATATCAAGCTGGG - Intergenic
1114668476 14:24396222-24396244 CTACACAAAGATCCCAAGCAGGG + Intergenic
1115052452 14:29079686-29079708 CTACACAAAGATATCAATTCTGG - Intergenic
1116259044 14:42598769-42598791 CAACACAAAAATATAAAGATGGG + Intergenic
1116381774 14:44277608-44277630 GTACACACACATATGAACCTGGG + Intergenic
1119357648 14:74020007-74020029 CTTTACAAACATCTCAAGTTTGG - Intronic
1124240763 15:28025786-28025808 CTACACACATACATCAAGCATGG - Intronic
1127029656 15:54847971-54847993 CTACCCAAACAGAACCAGCTGGG + Intergenic
1127201534 15:56658886-56658908 CTACACAAACATGTTAAAATTGG - Intronic
1128202355 15:65820125-65820147 CTACAAAAATATAGCAAGCATGG - Intronic
1129935793 15:79449348-79449370 CAACACAAACATACTAAGATAGG - Intronic
1132110568 15:99099541-99099563 CTGCACAAACATATCCGGATGGG + Intronic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1136578223 16:31136783-31136805 TTACACAATAATTTCAAGCTAGG + Intergenic
1136616128 16:31399603-31399625 CTTCACAGACATCTCAGGCTGGG - Intronic
1138405398 16:56788761-56788783 CTACACCACAGTATCAAGCTAGG - Intronic
1141311100 16:82913824-82913846 CTACACAAACCTCACTAGCTAGG - Intronic
1144181663 17:12757787-12757809 CAATACAAACAGATCAGGCTAGG - Intronic
1147846268 17:43406222-43406244 CTACACAAACACATAAACTTTGG - Intergenic
1150026461 17:61680358-61680380 AAACAAAAACATATCTAGCTAGG + Intergenic
1152182778 17:78834723-78834745 CTACAAAAACAAATCAAGGCCGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159268329 18:66113500-66113522 CTAAACAAACATAGAATGCTTGG + Intergenic
1159676016 18:71285196-71285218 TTAGACAAACATTTCAATCTAGG + Intergenic
1160301558 18:77686271-77686293 TTTCACAAACATATTCAGCTGGG - Intergenic
1162953246 19:14084231-14084253 CTACACAAAAATAATTAGCTGGG + Intronic
1167957889 19:53082507-53082529 CTCTACAAAAAAATCAAGCTGGG + Intronic
925623043 2:5812539-5812561 CAAAACAAAAAGATCAAGCTGGG - Intergenic
926656027 2:15407326-15407348 CTCCGCAAACATATCTTGCTGGG + Intronic
931025750 2:58112262-58112284 CTAGACAAACACATCCAGCCTGG - Intronic
932297480 2:70639126-70639148 CTACACAAAAATAAGAGGCTGGG - Intronic
937418716 2:121737620-121737642 CTAAACATACAAATTAAGCTGGG - Intronic
937570355 2:123350575-123350597 CTACATAAACCTAGCTAGCTTGG + Intergenic
940535689 2:154940387-154940409 GAAAACAAACATATCAAACTTGG + Intergenic
945295259 2:208164124-208164146 CTATACCAACATATCAATCATGG + Intergenic
1169052909 20:2595694-2595716 CTACACAAACCTATCCACCTGGG + Intronic
1169054511 20:2609640-2609662 CTACACAAACATATAATGAAGGG + Intronic
1171724135 20:28600386-28600408 ACTCACCAACATATCAAGCTGGG + Intergenic
1172662257 20:36575334-36575356 CTACACAAACTTCTCCACCTCGG - Intronic
1173568903 20:44064322-44064344 CTACAATAACATATGAACCTAGG + Intronic
1174940091 20:54917297-54917319 CTACACAAACATCTCCCACTAGG + Intergenic
1177453998 21:21311106-21311128 CTACACAAACATATCAAGCTGGG + Intronic
1177934164 21:27320984-27321006 CAACACAAACATTTCAACTTCGG - Intergenic
1177957241 21:27613978-27614000 CTACACATAGATATAAAGATGGG - Intergenic
1180297687 22:10959061-10959083 ACTCACCAACATATCAAGCTGGG + Intergenic
1183597249 22:38820081-38820103 TAACAGAAACACATCAAGCTTGG + Exonic
1183883232 22:40855158-40855180 CCACACAAAAATATCACGCTGGG + Intronic
950022861 3:9800800-9800822 CTACAGAAACTTATAAACCTGGG + Intronic
950076231 3:10189264-10189286 CGACACACACATATCTAGCCGGG + Intronic
957940166 3:86993036-86993058 CTAAAAAAACAAATTAAGCTGGG - Intergenic
958953529 3:100441964-100441986 CTATATAAAAATATAAAGCTAGG - Intronic
961098643 3:124179310-124179332 ATACACAAACATATTAGCCTAGG + Intronic
961520020 3:127461746-127461768 CTACAGAATCAAATCAAGCAGGG + Intergenic
962705432 3:138038862-138038884 CTACACAAACATTACAAGGTTGG + Intergenic
962827553 3:139111090-139111112 CTACAAAAAAAATTCAAGCTGGG - Intronic
973549475 4:52018754-52018776 CCACATGAACTTATCAAGCTAGG - Intergenic
975397087 4:73888263-73888285 CTAGACAATCATATCCAGCAAGG - Intergenic
975754466 4:77559091-77559113 CTAAACAACCATCTCACGCTGGG + Intronic
976050559 4:81007829-81007851 TCACACAAAGATATCCAGCTAGG + Intergenic
976112248 4:81688335-81688357 GTCCACATATATATCAAGCTAGG - Intronic
976814087 4:89126548-89126570 TTACACAAGAATAACAAGCTGGG - Intergenic
978724740 4:111956767-111956789 CTACACAAAAATAAAAAACTTGG - Intergenic
979523527 4:121695134-121695156 CCACACCAGCATATCAAGATAGG + Intronic
980827901 4:138094093-138094115 CTACACAGACATTTCATGCCAGG - Intergenic
981800950 4:148654893-148654915 CCCCAGAAACATATGAAGCTAGG + Intergenic
982201799 4:152968629-152968651 CTAAACAAATACATCAGGCTTGG - Intronic
982428280 4:155292981-155293003 CTAGACAAGAATATCATGCTCGG + Intergenic
983760543 4:171400900-171400922 CTACAAGGACATATGAAGCTAGG + Intergenic
984342343 4:178472989-178473011 TTACCCAAACAAATCAAGCAGGG + Intergenic
987054739 5:14180667-14180689 CTACAAAAAAATAAAAAGCTGGG + Intronic
989111309 5:37908776-37908798 CTACATAAATATCTGAAGCTGGG - Intergenic
989479806 5:41917406-41917428 CTGCATAAAGATATCCAGCTTGG + Exonic
993072052 5:83177466-83177488 CTTTAAAAACATATCGAGCTTGG + Intronic
994448996 5:99916801-99916823 CTACACAAAAATATCTGGTTTGG - Intergenic
994536166 5:101031921-101031943 CTAGATAAACATATCATTCTAGG + Intergenic
996770379 5:127079275-127079297 CAACACTAACATTCCAAGCTGGG - Intergenic
997379943 5:133428421-133428443 CTCCACAAGCATGTCAAGCAAGG - Intronic
997629041 5:135352810-135352832 CTACACTCAAATATCAATCTTGG + Intronic
999595478 5:153199141-153199163 TTCCACAAATATACCAAGCTGGG + Intergenic
1001143788 5:169166774-169166796 ATACACAAACCTATCTAGATAGG - Intronic
1006592219 6:35166758-35166780 CAAAACAAACATAGCAAGGTGGG - Intergenic
1007853178 6:44824875-44824897 ACACACAAACATGTCAGGCTGGG + Intronic
1014632025 6:123800353-123800375 CTACACCAAAAGCTCAAGCTTGG - Intergenic
1015114046 6:129627014-129627036 CTGCAGAAACATATCAGTCTAGG + Intronic
1016089704 6:139961738-139961760 CCACACATACATATTATGCTAGG - Intergenic
1022526214 7:31039088-31039110 CTTCACAGACACATCCAGCTCGG - Intergenic
1025962840 7:66238707-66238729 CTTCACAGACATATCTAGATTGG + Intronic
1028549035 7:92036445-92036467 CTACAAAAACATTTGTAGCTGGG - Intronic
1030364571 7:108630733-108630755 CTACACAAACATACCACACACGG - Intergenic
1030490391 7:110225433-110225455 CTACAAAAACAAGACAAGCTAGG + Intergenic
1030862002 7:114643807-114643829 CTACACTTACATATGAAGTTTGG - Intronic
1032464460 7:132135144-132135166 CTTGACAAACATATCTTGCTTGG - Intronic
1038418448 8:27415231-27415253 GTACCCAAGCATATCCAGCTGGG + Intronic
1040834815 8:51720698-51720720 CTTCACCAAAATATCCAGCTAGG - Intronic
1045185448 8:99832501-99832523 CTTCAGAAACAGATCATGCTGGG + Exonic
1045301556 8:100915210-100915232 CAAGACAAACATAACAAGATTGG - Intergenic
1045495248 8:102702606-102702628 CAGCACAAACAGATAAAGCTGGG - Intergenic
1045580073 8:103468662-103468684 CTATAAAAATATTTCAAGCTGGG - Intergenic
1046638244 8:116696947-116696969 GTACACAAACAAAAAAAGCTAGG + Intronic
1048248954 8:132841841-132841863 GTACACAAACATATAATGGTAGG + Intronic
1049713818 8:144080127-144080149 CTGCACATAGATATCAATCTGGG - Exonic
1053725469 9:40994683-40994705 ACTCACCAACATATCAAGCTGGG - Intergenic
1054789817 9:69245717-69245739 CTACACAAACTTTGCAAGGTAGG - Intronic
1058768312 9:108205285-108205307 CTACACAAATATAGCAGGATGGG + Intergenic
1059751784 9:117254297-117254319 CTACACAAACATTTAGAACTGGG - Intronic
1060004143 9:119984656-119984678 CTATACAGACATCTCCAGCTTGG + Intergenic
1187684994 X:21807255-21807277 CTACACAAAAATATGAAGTCAGG + Intergenic
1188181518 X:27061988-27062010 CAACACAAACTTTTCATGCTTGG + Intergenic
1189096980 X:38150849-38150871 CAACACAAACATATTTAGATGGG + Intronic
1194700329 X:97105908-97105930 TTACACAAATATATGAAGTTGGG + Intronic
1196659691 X:118256844-118256866 CCACACAGCCATATCAAGGTTGG + Intergenic
1197471650 X:126870434-126870456 CAACCCAAACATATCCTGCTAGG + Intergenic
1198090551 X:133324478-133324500 CTTCACAAACATATCATTCAGGG + Exonic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1202348700 Y:23963552-23963574 ATACACACTCATATCAAGATAGG - Intergenic
1202522074 Y:25706552-25706574 ATACACACTCATATCAAGATAGG + Intergenic