ID: 1177454371

View in Genome Browser
Species Human (GRCh38)
Location 21:21316902-21316924
Sequence CCATTAGCACATAAACCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177454368_1177454371 -3 Left 1177454368 21:21316882-21316904 CCTGTATATTGGTCCTTGGACCA 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1177454371 21:21316902-21316924 CCATTAGCACATAAACCCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 92
1177454367_1177454371 -2 Left 1177454367 21:21316881-21316903 CCCTGTATATTGGTCCTTGGACC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1177454371 21:21316902-21316924 CCATTAGCACATAAACCCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 92
1177454366_1177454371 -1 Left 1177454366 21:21316880-21316902 CCCCTGTATATTGGTCCTTGGAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1177454371 21:21316902-21316924 CCATTAGCACATAAACCCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177454371 Original CRISPR CCATTAGCACATAAACCCCC CGG Intronic
905929740 1:41778727-41778749 CCTCTAGCACATAAGCTCCCAGG - Intronic
908176572 1:61561499-61561521 CCATTAGAATATAAACTCCAAGG - Intergenic
909739282 1:79007880-79007902 CCAGTAGTTCATAATCCCCCTGG - Intergenic
911787133 1:101965227-101965249 ACAATAGTATATAAACCCCCAGG + Intronic
915818043 1:158991374-158991396 CCATTTGCCCATAAACATCCAGG - Intergenic
916964830 1:169927541-169927563 CCATTAGAAAATAAACACCATGG + Intronic
918473748 1:184901834-184901856 CCATTAACACATCATCCACCAGG + Intronic
920232211 1:204478168-204478190 CCATTAGGACTTAAACCCTTTGG + Intronic
920903827 1:210139637-210139659 CCATTAGCAATTACACCTCCTGG + Intronic
924153554 1:241153133-241153155 TGATTTGCACATAAACCCACAGG + Intronic
1065755813 10:28929679-28929701 GCATTAGCAGAAAAACACCCAGG - Intergenic
1066968355 10:42291928-42291950 CCATTAGCTCAAAAACCAACTGG - Intergenic
1067460389 10:46453967-46453989 TCATTAGAACATGAACCCCATGG - Intergenic
1067626803 10:47930636-47930658 TCATTAGAACATGAACCCCATGG + Intergenic
1075016574 10:118914034-118914056 TAAATAGCACATCAACCCCCCGG - Intergenic
1075805733 10:125187575-125187597 CCATGAGCAAGTAAACCTCCTGG - Intergenic
1077035511 11:492578-492600 CCATTTGCACCCACACCCCCGGG + Intergenic
1079814663 11:25040365-25040387 CCAATAGCACAGAATACCCCTGG + Intronic
1086635546 11:89078934-89078956 GCATTAGCACATGAAGCCTCCGG + Intergenic
1088237773 11:107743474-107743496 CCCTTAGCACAAAAACAGCCAGG + Intergenic
1090119464 11:124009737-124009759 CAGTAAGCACATAAACCACCAGG - Intergenic
1090673356 11:128966922-128966944 CCTTTGGCACAAAAACACCCTGG - Exonic
1093793259 12:23280006-23280028 CTTTTAGCCCATAAACCCCAGGG - Intergenic
1098545755 12:71709394-71709416 CCATTAGCACAATTACCCACTGG - Intergenic
1099446446 12:82757836-82757858 GCATTAACATATAAACCCCTAGG + Intronic
1102701450 12:114843018-114843040 ACATTAGAACATAAACTCCCTGG - Intergenic
1104149609 12:126070114-126070136 CCATTAGCTCAAAAGCCCACTGG - Intergenic
1106021357 13:25918906-25918928 CCATTTGAACACCAACCCCCAGG - Intronic
1113801477 13:113088752-113088774 CCGTCAGCACATAAACACCAGGG - Intronic
1115923166 14:38400869-38400891 ACATTAGCAAATAGACCACCTGG + Intergenic
1117658415 14:57980043-57980065 CCATTACCAAATAAACTACCTGG + Intronic
1120160865 14:81143159-81143181 CCAGGAGCTCAAAAACCCCCAGG + Exonic
1125090851 15:35790913-35790935 CCATTAAAATATAAACCCACTGG - Intergenic
1125279745 15:38031081-38031103 GAATTAGCATATAAACACCCAGG + Intergenic
1126935980 15:53708225-53708247 CCATTAGCACTGAAATCCCTGGG + Intronic
1130127861 15:81109085-81109107 GCATGAGCAGATAAACACCCAGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1135546472 16:23370428-23370450 CCCTTAGCACATCACCCCGCAGG + Intronic
1136734436 16:32451454-32451476 CCATTAGCTCAAAAACCAACTGG - Intergenic
1140190212 16:72809426-72809448 CCAGTAACACAGAAACCCACTGG + Intronic
1203018644 16_KI270728v1_random:378148-378170 CCATTAGCTCAAAAACCAACTGG + Intergenic
1203036979 16_KI270728v1_random:651306-651328 CCATTAGCTCAAAAACCAACTGG + Intergenic
1144270905 17:13614899-13614921 CATAAAGCACATAAACCCCCTGG + Intergenic
1146273300 17:31498403-31498425 CCATCAGCACATAGCCCCCATGG - Intronic
1146414865 17:32622416-32622438 CCATTAGAACATAGACTCCATGG - Intronic
1146585880 17:34081126-34081148 CCAATTGCACTGAAACCCCCTGG + Intronic
1150641582 17:66953239-66953261 CACTTAGCACCTCAACCCCCCGG + Intergenic
1151057780 17:71053441-71053463 CCATTAGCATATGAATCTCCAGG - Intergenic
1156068808 18:33178518-33178540 CCATTAGCACCTTAAAACCCTGG + Intronic
1156383363 18:36583724-36583746 CCATGAGAGCATAAACCCCTTGG - Intronic
1157995987 18:52556669-52556691 ACAATAGCACATGCACCCCCAGG + Intronic
1168465494 19:56598052-56598074 CCATGAGAACAGAAGCCCCCAGG - Intronic
927558564 2:24052665-24052687 CCATTAGAATATAAACTCCAGGG + Intronic
934311296 2:91867995-91868017 CCATTAGCTCAAAAACCAACTGG + Intergenic
937638945 2:124189862-124189884 CTCTTAGCACATCAACCCCTCGG + Intronic
940207946 2:151224808-151224830 CTATTAGAAAATAAACTCCCTGG - Intergenic
942844279 2:180404136-180404158 GCTTTAGCAGAGAAACCCCCAGG + Intergenic
943996890 2:194779965-194779987 CCAATAGAGCATAAAACCCCTGG + Intergenic
945144250 2:206720155-206720177 GCATTAGCAGAAAAACACCCAGG + Intergenic
1170505323 20:17019977-17019999 CCATTGGCACATATACACCATGG + Intergenic
1171296132 20:24018835-24018857 CTGTTGCCACATAAACCCCCAGG - Intergenic
1177454371 21:21316902-21316924 CCATTAGCACATAAACCCCCCGG + Intronic
1182667054 22:31967644-31967666 CCAAGAGCCCATAAAGCCCCAGG + Intergenic
1182962520 22:34488869-34488891 ACATTAGCTCATAAATGCCCTGG - Intergenic
1184993949 22:48189239-48189261 CCCTTAGCAAATAAATCTCCAGG - Intergenic
951225086 3:20111548-20111570 TCAATATCCCATAAACCCCCAGG - Intronic
958851922 3:99337540-99337562 CCAGTAGCACATAAACCAACTGG - Intergenic
962423830 3:135251406-135251428 CCATTGTCACGTAATCCCCCAGG + Intronic
973819273 4:54648532-54648554 CCATCAGCACATGAACCATCAGG + Intergenic
975211260 4:71702771-71702793 CCTATAGCATATGAACCCCCTGG - Intergenic
979665278 4:123304318-123304340 ACATGAGCACATAATCTCCCAGG + Intronic
985461333 4:190109736-190109758 GCATTAGGACATAAACCTCTGGG + Intergenic
988352711 5:30132188-30132210 CAATTATCAAATAAAACCCCAGG - Intergenic
992672154 5:79071157-79071179 CCATTAACACCTTAACTCCCAGG - Intronic
997210689 5:132075031-132075053 CTGTTGGCACAGAAACCCCCTGG - Intronic
997430450 5:133835609-133835631 CCATGAGCACATAAGACCACAGG + Intergenic
1001168669 5:169395198-169395220 CCTTAAGAACATAAATCCCCAGG + Intergenic
1003337319 6:5186101-5186123 CCCTTAACACCTCAACCCCCTGG - Intronic
1010756322 6:79669743-79669765 CCACTAGAATATAAATCCCCTGG - Intronic
1011243819 6:85300723-85300745 CCAGCAGCACATACACCCCCGGG + Intergenic
1034192214 7:149221482-149221504 CTATATGCACATAAACTCCCAGG - Intronic
1035735393 8:1883648-1883670 CCATCACCAAATAAACCCCTCGG - Intronic
1036404321 8:8441412-8441434 CCAGCACCACACAAACCCCCTGG + Intergenic
1041528276 8:58833733-58833755 TCATTAGCATTTAAAACCCCCGG + Intronic
1043332971 8:79140252-79140274 CCCATATCACATAAACTCCCAGG + Intergenic
1044979937 8:97706767-97706789 TCATTAACAAATAAACACCCAGG - Intronic
1057691563 9:97291083-97291105 CCCTTAGCATATGAACTCCCTGG - Intergenic
1058097521 9:100880004-100880026 CCATTAGCACATAACATTCCTGG - Intergenic
1061479980 9:130892907-130892929 CCATGAGCACAAGATCCCCCTGG - Intergenic
1186072757 X:5840384-5840406 ACATTGGCACATAAACCACTGGG - Intergenic
1188192531 X:27189577-27189599 CCCTTAGGCCATAAACCCTCAGG - Intergenic
1194097002 X:89653524-89653546 CCATTAGCTCATACACCCATGGG + Intergenic
1198864762 X:141109867-141109889 CCATAATCTCATAAACACCCAGG + Intergenic
1200260292 X:154612101-154612123 GCATTAGGACATAAACCTCTGGG + Intergenic
1200450022 Y:3314904-3314926 CCATTAGCTCATACACCCATGGG + Intergenic
1200752784 Y:6962103-6962125 GCATTAGGACATAAACCTCTGGG + Intronic