ID: 1177462337

View in Genome Browser
Species Human (GRCh38)
Location 21:21429397-21429419
Sequence AGTATATTCTGGGGGATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177462337_1177462343 9 Left 1177462337 21:21429397-21429419 CCTCTCATCCCCCAGAATATACT 0: 1
1: 0
2: 0
3: 26
4: 193
Right 1177462343 21:21429429-21429451 TTTGACACATGTCCCCAAACTGG 0: 1
1: 0
2: 1
3: 16
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177462337 Original CRISPR AGTATATTCTGGGGGATGAG AGG (reversed) Intronic
900247213 1:1642321-1642343 AGTCTTTTCTGGGGGATGTTTGG - Intronic
900258437 1:1709453-1709475 AGTCTTTTCTGGGGGATGTTTGG - Intronic
902236862 1:15063315-15063337 AGAAGATGCTGGGGGTTGAGAGG + Intronic
903158912 1:21470659-21470681 AATCTATGCTGAGGGATGAGCGG + Exonic
905298363 1:36969048-36969070 AGTGTAATTTGGGGGAAGAGAGG - Intronic
908113041 1:60915957-60915979 AGTAGGTGCTGGAGGATGAGAGG - Intronic
908483468 1:64567061-64567083 TGTAGATACTGGGGAATGAGTGG + Intronic
909175621 1:72354370-72354392 AGTGTATGCTTGGGGATGGGAGG - Intergenic
909475937 1:76080945-76080967 AGCACATTGTGGGGAATGAGTGG + Intronic
909721410 1:78775255-78775277 AATATATTTTGGGGGATCTGAGG + Intergenic
909963948 1:81884097-81884119 CGGCTATTCTGGGGGCTGAGGGG - Intronic
911079408 1:93913450-93913472 TGTATTTTCTGTGGGATCAGTGG + Intergenic
913141446 1:115945284-115945306 AGTAGATTCATGTGGATGAGGGG - Intergenic
916138814 1:161675827-161675849 AGAAAATTCTGGGGGACTAGGGG + Intronic
916385512 1:164263199-164263221 AGTATTTTCTGGGGATTGTGAGG + Intergenic
917098329 1:171422124-171422146 AGTTTTTTCTGGGGGGGGAGGGG - Intergenic
917513493 1:175687863-175687885 AGCGTATTCTGGGGGAGGGGAGG - Intronic
917918956 1:179733608-179733630 CATAAATTATGGGGGATGAGGGG - Intergenic
918702510 1:187622603-187622625 ACTAAATTCTGGGCAATGAGAGG + Intergenic
919154161 1:193740677-193740699 AGTATGTTTTGGGGTATCAGAGG + Intergenic
919321750 1:196049801-196049823 AGTATGTTATGGGGGAAGAGAGG - Intergenic
920401358 1:205678871-205678893 AGCATATTGTAGGGGATAAGTGG - Intronic
924200681 1:241655388-241655410 ACTATTTTTTGGGGGGTGAGGGG - Intronic
924395502 1:243615543-243615565 ATTTTATTCAGGGGGATGAAAGG + Intronic
1062986228 10:1771774-1771796 AGTATGGTCTGGGGCATGAGAGG + Intergenic
1063940353 10:11122246-11122268 TGTATAGTTTGGGGGATGACAGG - Intronic
1067181058 10:43986305-43986327 AGTATATAGGGTGGGATGAGGGG - Intergenic
1067961891 10:50863596-50863618 ATGATATTTTGGGGGATGAGAGG - Intronic
1067993284 10:51240135-51240157 AATATATTCTGCAGAATGAGTGG + Intronic
1068174162 10:53436003-53436025 AGTCTATTTTGGGGGGTGCGGGG + Intergenic
1068987498 10:63120740-63120762 AGTGAATCATGGGGGATGAGGGG + Intergenic
1071602480 10:86965093-86965115 AGTGTATCCTGGTGGATAAGGGG - Intronic
1079959741 11:26908433-26908455 AATATATTATGGGTGATAAGTGG + Intergenic
1081527184 11:43935106-43935128 AGAATCCTCTGGAGGATGAGGGG - Intronic
1083088985 11:60180389-60180411 AGTGGAGTCTGGGAGATGAGGGG - Intronic
1084512984 11:69617630-69617652 AGAATGTCCTGGGGGACGAGGGG + Intergenic
1085003223 11:73060626-73060648 AGTGTTTTCAGTGGGATGAGTGG - Intronic
1088185150 11:107158765-107158787 AGTCAATCCTGGGGGAAGAGAGG - Intergenic
1089453474 11:118612389-118612411 AGCATTTTCTGAGGGAGGAGGGG - Intronic
1091339006 11:134795781-134795803 ATTATCTTCTGGAGGAGGAGAGG + Intergenic
1094314388 12:29121700-29121722 AGTATTTTCTGGGACCTGAGTGG - Intergenic
1094316137 12:29139028-29139050 ATTATAGTGTGGGGGATCAGAGG + Intergenic
1094651951 12:32387119-32387141 AGCATATTCTGGGGCATGGCTGG - Intergenic
1095199441 12:39365166-39365188 AGTATAATTTGGTGAATGAGGGG - Intronic
1104684431 12:130775644-130775666 AGTATGTTTTGGGGGATAGGTGG - Intergenic
1106906874 13:34418805-34418827 GGTATTTTCTGGGGGGTGGGGGG - Intergenic
1106936111 13:34722168-34722190 TGTATATTTTGGGAAATGAGAGG - Intergenic
1107372965 13:39772281-39772303 AATATATTCTGGAGGCTCAGAGG - Intronic
1109925754 13:69136426-69136448 TATATATTTTGGGGGATGAGAGG + Intergenic
1111196354 13:84878862-84878884 AGTGTATCCTGGGGCATAAGTGG + Intergenic
1112582350 13:100687472-100687494 AGAATTTTCTGGGGGAAGTGGGG + Intergenic
1112789769 13:102990099-102990121 AGTATATGCTGATGGATCAGTGG - Intergenic
1114756896 14:25269666-25269688 AGCAAAGTTTGGGGGATGAGTGG - Intergenic
1119020869 14:71112626-71112648 ACTATTCTCTGGGGGGTGAGGGG - Exonic
1119222884 14:72923701-72923723 TTTATATTTTGGGGGATGGGAGG + Intergenic
1121392652 14:93589423-93589445 AGTATGGGCTGGGGGATGGGGGG + Intronic
1124465960 15:29940074-29940096 AAGATATTCTGGGGGAAGACTGG + Intronic
1125169866 15:36754158-36754180 AGTATATTCTGGCAGACAAGTGG + Intronic
1125951576 15:43757096-43757118 CTTACATTCTGGGGGATGAGGGG + Intronic
1126304359 15:47238397-47238419 GGTATACTCTGGGGGGTGAGGGG - Intronic
1126681028 15:51202364-51202386 AGTCTATTCTGGGGGTGCAGTGG + Intergenic
1126838945 15:52696880-52696902 ATTATATTCTGGGGGATTCATGG + Intronic
1128713936 15:69893315-69893337 AGAACATTGTGGGGGATGAGAGG - Intergenic
1130570407 15:85037455-85037477 AGTATATTTTGTGGGGTGAGAGG - Intronic
1130694974 15:86122117-86122139 AGTAGATTCTGGCTGCTGAGAGG - Intergenic
1131553090 15:93374671-93374693 AGGATATTATAGGGGATGAGGGG + Intergenic
1132227625 15:100154768-100154790 TGAATTTGCTGGGGGATGAGGGG - Intronic
1141204098 16:81920018-81920040 GGTATGTTCTGGAGGAAGAGAGG + Intronic
1142789586 17:2253616-2253638 AGAATATTCTGGTGGCGGAGGGG - Intronic
1142952490 17:3495031-3495053 AGTAGATTCTGGGGGTTCTGAGG - Intronic
1142954647 17:3513383-3513405 TGGATATCCTGGGGGAGGAGGGG - Exonic
1143453447 17:7050773-7050795 AGGGCATTCTGGGGGGTGAGGGG - Intergenic
1144756240 17:17682035-17682057 AGGGTCTTCTGGGGGATGTGCGG + Intronic
1146534425 17:33637894-33637916 AGGATAGTTTGGCGGATGAGGGG + Intronic
1150367327 17:64601077-64601099 ATTATTTTGTGGGGGATGGGGGG - Intronic
1153309890 18:3667708-3667730 AGAATATGCTGGGGCCTGAGAGG + Intronic
1154965491 18:21351655-21351677 ATTACATTCTGGGGTATGATAGG + Intronic
1157374108 18:47147887-47147909 AGTATATTTTGAGGTATGAGTGG - Intronic
1157814955 18:50723570-50723592 AGTATTTTCTGGGGCAGGTGTGG + Intronic
1159235380 18:65664911-65664933 AATATATTCTGGAAAATGAGTGG + Intergenic
1159671772 18:71228933-71228955 GATATATTTTGGGGGATTAGTGG + Intergenic
1160251808 18:77209961-77209983 AGTATCTTCAGGTGGATGTGGGG + Intergenic
1161915301 19:7223914-7223936 AGTCTATTCTGGTGGCTTAGAGG - Intronic
1162272825 19:9630220-9630242 AGGAAATTCTGGGGGTTGACTGG + Intronic
1165172295 19:33902664-33902686 AATATATCCTGGAGGATGGGGGG - Intergenic
1167057393 19:47120577-47120599 TGGATATTCTGGGGGGTGGGGGG - Intronic
1167356262 19:49006134-49006156 AGTATCTGCTGAGGGCTGAGTGG - Intronic
925259744 2:2519218-2519240 AGTATATTCTGTGCCCTGAGTGG - Intergenic
926494723 2:13571959-13571981 AGTATATTCAGGGAGATTTGTGG - Intergenic
926856502 2:17262220-17262242 AATATTTTCTGGTGGAGGAGGGG - Intergenic
928202183 2:29254995-29255017 AGTGGATTCTGTGGGAAGAGAGG + Intronic
928208720 2:29307169-29307191 AGTATTTTCTGTGGGTTGAAGGG - Intronic
929581238 2:43082861-43082883 AGGAGGTACTGGGGGATGAGGGG - Intergenic
929793770 2:45042574-45042596 AGTGAATTCTGGGGGAGGAGAGG - Intergenic
930726967 2:54692069-54692091 AGGAGATCCTGGAGGATGAGAGG - Intergenic
932436398 2:71704753-71704775 AACAGATGCTGGGGGATGAGAGG - Intergenic
936063558 2:109313669-109313691 AAAACATTCTGGGAGATGAGTGG + Intronic
936140780 2:109938408-109938430 AGCAGAGTCTGGAGGATGAGCGG + Intergenic
936177471 2:110236353-110236375 AGCAGAGTCTGGAGGATGAGCGG + Intergenic
936203913 2:110433078-110433100 AGCAGAGTCTGGAGGATGAGCGG - Intronic
936852496 2:116917719-116917741 AGTAGTTTCAGGGGTATGAGTGG - Intergenic
939365995 2:141231749-141231771 AGAATTTCCTGGGGGAGGAGAGG - Intronic
939464757 2:142543203-142543225 ATTATGTTTTGGGGGATGACAGG - Intergenic
939608926 2:144286684-144286706 AATATATTCTGGGGGAACACTGG - Intronic
940231091 2:151453163-151453185 TGTATATTCTGGGGGGAGGGGGG - Intronic
943786576 2:191884070-191884092 AGTAGATTCTGTGGGATGGGGGG - Intergenic
944736408 2:202570787-202570809 AGTTTTTTCAGGGGGATGAGAGG + Intergenic
946484054 2:220084086-220084108 GGTACCTTCTGGGGAATGAGAGG + Intergenic
946993516 2:225363569-225363591 AATATATTTTGGGAGGTGAGTGG - Intergenic
947204100 2:227644532-227644554 AGTATATTCTGGGAGAGATGAGG + Intergenic
947904999 2:233754889-233754911 AGAATATTTTGGGGGGTCAGAGG - Intronic
1169495385 20:6110014-6110036 AGTATATTTTGTGGGATGTAGGG - Intronic
1170100499 20:12694024-12694046 AGTATATTTTGTGTGTTGAGAGG + Intergenic
1172983618 20:38964320-38964342 GGTATATTTTGGGGTATGACAGG + Intronic
1173343440 20:42175856-42175878 AGTAGAATCTAGGGGATGACTGG + Intronic
1173345694 20:42198019-42198041 AAAATCTCCTGGGGGATGAGAGG - Intronic
1175622998 20:60466560-60466582 AGTACCTGCTGGGAGATGAGAGG + Intergenic
1175982434 20:62745847-62745869 TGAATATTCTGGGGGACGCGTGG - Intronic
1177462337 21:21429397-21429419 AGTATATTCTGGGGGATGAGAGG - Intronic
1180976280 22:19850614-19850636 CTTTGATTCTGGGGGATGAGTGG - Exonic
1181916349 22:26283806-26283828 AGAATATTATGGGGGAGGAAAGG + Intronic
1183242943 22:36671915-36671937 GGTGTATTCTTGGGGATAAGAGG + Intronic
950634908 3:14307827-14307849 AGTATGTGCTGGAGGAGGAGGGG - Intergenic
951484935 3:23201323-23201345 AGGAAGTTCTGGGGGAGGAGTGG + Intergenic
952223868 3:31353426-31353448 AGTACATTATGATGGATGAGAGG - Intergenic
953036685 3:39217680-39217702 AGCATTTACTGAGGGATGAGGGG - Intergenic
954558258 3:51535229-51535251 ATTATAATCTGGGTGATGAGTGG + Intergenic
954580890 3:51702431-51702453 GGCATATTCTGGGGGCTGAGTGG + Intronic
954755137 3:52835135-52835157 AGTTTATTCTCGGAGATGAGAGG + Exonic
955948453 3:64218146-64218168 GGAGTATTCTGGGGAATGAGGGG - Intronic
958680416 3:97323445-97323467 AGAATATTAGGGGGGATGGGTGG + Intronic
958682636 3:97351817-97351839 AGTATAGTTTGGAAGATGAGAGG + Intronic
958889077 3:99763327-99763349 AATGTACTCTGGGAGATGAGAGG + Intronic
960158862 3:114327329-114327351 AGTATAATATGGAGGAGGAGAGG - Intergenic
961942710 3:130654843-130654865 AGGATAGTTTGGGGGAAGAGGGG + Intronic
962862262 3:139414895-139414917 AGTGGAGTCTGGGGGATGAGTGG - Intergenic
964392977 3:156216626-156216648 AGTAGACTCTGGGGGAAGATAGG + Intronic
969548038 4:7844833-7844855 AGATGATTCTGGGGGCTGAGGGG - Intronic
969955594 4:10887509-10887531 AGTGTTTTCTGGGGGGTGACTGG + Intergenic
970640796 4:18063943-18063965 AGGATATTCTGAGAGATTAGAGG - Intergenic
973021697 4:45210791-45210813 TGTATAATCTTGAGGATGAGTGG - Intergenic
974468598 4:62290665-62290687 AATTTATTCTGGGGGTAGAGTGG + Intergenic
974681256 4:65165812-65165834 ATTTTATTCAGGGGAATGAGAGG + Intergenic
976111954 4:81684995-81685017 AGTATTTTCTTGAGGAAGAGAGG - Intronic
978644671 4:110915749-110915771 CATATATTCTAGGGGATGATGGG + Intergenic
979408969 4:120350949-120350971 AGTATATTTTGGGAGAAGATGGG + Intergenic
980168685 4:129260349-129260371 AGAATGTTCTGTGGGATGAGAGG - Intergenic
980768322 4:137337347-137337369 AGTATATTCTGGAGACTGGGTGG - Intergenic
983476996 4:168225445-168225467 AGTTTATTCTGGAAGAAGAGTGG - Intronic
983715707 4:170778775-170778797 AGTCTATTCTGGAGAATAAGAGG + Intergenic
984047935 4:174825302-174825324 GGTATGTTTTGGAGGATGAGAGG - Intronic
984176041 4:176418182-176418204 TGCATATTCTGGGGTTTGAGGGG + Intergenic
984260912 4:177442805-177442827 AGTATATTCTTGGGGATCCCAGG + Intergenic
986535822 5:8785878-8785900 GCTATATTCTGGAGGATAAGAGG - Intergenic
986633447 5:9797111-9797133 AGAGCATTATGGGGGATGAGAGG + Intergenic
996508049 5:124289521-124289543 AGTAAATTATGGGGGAGGAAAGG + Intergenic
996572896 5:124951697-124951719 AATTTATTCTGGTGGGTGAGGGG - Intergenic
996830040 5:127730194-127730216 TGTATATTCTGTGGGGTCAGTGG - Intergenic
997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG + Intronic
999142172 5:149369722-149369744 AGTATCTTCTGGGGAAGGGGAGG + Intergenic
999550819 5:152685533-152685555 AGTAGAGTCTGGGGGAAGAAAGG + Intergenic
999591165 5:153148235-153148257 ATTATATACAGGGGTATGAGGGG - Intergenic
999631281 5:153573914-153573936 AGTATAAGCTGGGTGATTAGGGG + Intronic
1000025384 5:157354556-157354578 GGTATATTTGGGGGAATGAGGGG + Intronic
1001504413 5:172265804-172265826 ACAATATTCTGGGGGAAGACGGG + Intronic
1002708182 5:181177397-181177419 AGTTCATTCTGGTCGATGAGAGG + Intergenic
1008428118 6:51382601-51382623 AGTATATTCCAGGAAATGAGTGG + Intergenic
1009507253 6:64500143-64500165 AGGATATTCTGGGGCAGGGGAGG - Intronic
1010931514 6:81809611-81809633 ACTATATTGTGGAGTATGAGCGG + Intergenic
1011006150 6:82647587-82647609 AGTAGAATCTGGGGGATGAAGGG - Intergenic
1012029982 6:94047081-94047103 AGTAAATTCTGTGGGGTTAGTGG - Intergenic
1012076516 6:94693343-94693365 AGTTTTTTATGGGGGAGGAGTGG + Intergenic
1013766685 6:113582379-113582401 AGTATATTCTAGGTGTTGAGAGG - Intergenic
1014750135 6:125245932-125245954 AGCAGAATCTGGGGGGTGAGTGG - Intronic
1015364652 6:132384348-132384370 AGTATATGCTGGGGAAAGAAAGG - Intronic
1015941629 6:138458385-138458407 AGGCTACTTTGGGGGATGAGAGG - Intronic
1016768866 6:147826474-147826496 AGAATATTCTGTGGCATTAGAGG - Intergenic
1017479845 6:154841594-154841616 CGTATATTTTTGGGGTTGAGAGG + Intronic
1020974589 7:14989012-14989034 AGAATATTCTGAGCGATGTGGGG + Intergenic
1023088015 7:36591734-36591756 AGTTTCTATTGGGGGATGAGAGG - Intronic
1024389606 7:48792964-48792986 AGTAGATTCTCAGGAATGAGAGG + Intergenic
1027439538 7:78204281-78204303 AATAGTTTCTGGGTGATGAGGGG - Intronic
1028740938 7:94274156-94274178 AGGAAATCATGGGGGATGAGGGG + Intergenic
1029887597 7:103889585-103889607 AGTATCTTCTGGGGAAGGAGTGG - Intronic
1035272515 7:157728824-157728846 AGTCTCTTCTGGGGGATTTGAGG - Intronic
1035874292 8:3170548-3170570 AGTATATTCTGTGCTATGGGAGG - Intronic
1037238824 8:16753690-16753712 ATTAAATTATTGGGGATGAGTGG - Intergenic
1039378468 8:37061483-37061505 AGGATGTGCTGGGGGAAGAGGGG + Intergenic
1039513813 8:38113700-38113722 AGCTTATTCTGGGTGATGACTGG + Intronic
1040738753 8:50545989-50546011 TGTATATTTTGGGGGATCTGAGG + Intronic
1041573528 8:59366249-59366271 TGTAAATTCTAAGGGATGAGAGG + Intergenic
1042532418 8:69829868-69829890 AATATATTTTGGGAGATGGGAGG - Intronic
1043810728 8:84736356-84736378 AGTATAATTTGGGGGATGACTGG + Intronic
1044216506 8:89617895-89617917 AGAAAATTCTGGGCGATGAGAGG + Intergenic
1046558529 8:115807956-115807978 AGTATTCTCTGGGGGAAGAAAGG + Intronic
1048065406 8:130962526-130962548 AGTATGTTATGTGAGATGAGAGG - Intronic
1048546310 8:135390739-135390761 AGAATATTCTAGGAGATAAGAGG - Intergenic
1048581494 8:135732758-135732780 AATAAGTTTTGGGGGATGAGAGG + Intergenic
1048645717 8:136417190-136417212 AGGCTATGCTGGGGAATGAGAGG + Intergenic
1048795151 8:138142970-138142992 AGTTAATGCTGGGGGAAGAGGGG - Intronic
1050590784 9:7158171-7158193 AGTATTCTCTGTGGGATCAGTGG + Intergenic
1053336590 9:37279082-37279104 AGTAAATTCTTTGGGATGAAGGG + Intronic
1057035062 9:91805951-91805973 AGTATATTCGGGCAGTTGAGGGG + Intronic
1058263844 9:102873178-102873200 AGTGTGTTCTGGTGGAAGAGAGG + Intergenic
1060907939 9:127324556-127324578 AGTAGATTCTGGTTGATAAGCGG - Intronic
1062483203 9:136762014-136762036 AGTCTGTTCTGGGGGAGGTGGGG + Intronic
1187948027 X:24445541-24445563 AATATCTTCTGGGGCATGGGAGG + Intergenic
1188883747 X:35523833-35523855 AGTAATTTCTAGGAGATGAGAGG - Intergenic
1189200398 X:39190663-39190685 GGAATATTCTGGGGTATTAGGGG - Intergenic
1189312559 X:40030142-40030164 AGTTTCTTCTGGGGGTTGTGAGG - Intergenic
1192598077 X:72432463-72432485 AGTGTATTCTGGGTGCTGAAAGG - Intronic
1193222744 X:78945985-78946007 AATAGATTCTGGGGGCTGAAAGG + Intronic
1194062102 X:89216397-89216419 AGTATAGGCTGGGGGAAGAGAGG - Intergenic
1194278165 X:91913202-91913224 AGTCCAGTCTGGGGGATGGGAGG + Intronic
1194622722 X:96193164-96193186 AACATATTTTGGGGGGTGAGAGG - Intergenic
1196988611 X:121302542-121302564 AGTGAATTCTGGGGGATGGGTGG + Intergenic
1198013221 X:132581538-132581560 AATATATACTGGAGGAAGAGAGG - Intergenic
1199482977 X:148318223-148318245 AGTAGATACTGAGGGCTGAGGGG + Intergenic
1200716026 Y:6545690-6545712 AGTATAGGCTGGGGGAAGAGAGG - Intergenic
1200754298 Y:6975878-6975900 AGTATATTCAAGGCTATGAGGGG - Intronic