ID: 1177467462

View in Genome Browser
Species Human (GRCh38)
Location 21:21506119-21506141
Sequence TCTCACATGCAGATAGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177467462_1177467465 24 Left 1177467462 21:21506119-21506141 CCTAGAACTATCTGCATGTGAGA 0: 1
1: 0
2: 2
3: 16
4: 158
Right 1177467465 21:21506166-21506188 AGTGATCCATTCAAACCAATAGG 0: 1
1: 0
2: 1
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177467462 Original CRISPR TCTCACATGCAGATAGTTCT AGG (reversed) Intronic
901913104 1:12476966-12476988 TTTCACCTGCAGATAGAACTAGG + Intronic
905195463 1:36273294-36273316 GCTCACATGGAGTCAGTTCTCGG + Intronic
905516051 1:38562923-38562945 TCTCACATTTGGAAAGTTCTCGG + Intergenic
907641286 1:56193177-56193199 TCTCACATAAAGATAGGTTTGGG - Intergenic
908103444 1:60814652-60814674 TCTCACAGGCTTTTAGTTCTAGG + Intergenic
909118241 1:71567237-71567259 TATCTCAAGCAGATAGTTTTTGG - Intronic
911115284 1:94239721-94239743 TCTCACATGCAAACAGTTCTGGG + Intronic
912373765 1:109193596-109193618 TCTCAGATGCAGAAAGTACATGG - Intronic
912775449 1:112503990-112504012 TCTCACTTCCAGATCATTCTAGG + Intronic
914442789 1:147721958-147721980 TTCCACATTCAGAGAGTTCTTGG + Intergenic
916943723 1:169702848-169702870 TCTCATATACAGATAGATTTTGG + Intronic
916983592 1:170166635-170166657 TTTGACCTGCAGGTAGTTCTGGG - Exonic
917422274 1:174877031-174877053 TATTACATGAAGATTGTTCTTGG - Intronic
917812066 1:178668731-178668753 TAGAACATGCAAATAGTTCTTGG + Intergenic
918072172 1:181141180-181141202 TGTCACCTGCAGATAGTCATGGG - Intergenic
921876352 1:220200922-220200944 GCCCACATGCACATAGATCTAGG + Intronic
922122610 1:222687530-222687552 CCTCTCTTTCAGATAGTTCTGGG - Intronic
924780493 1:247143041-247143063 TCTCACATGCAGATTCTTTATGG - Intronic
1065966230 10:30772814-30772836 TCTCACATTCTGAAAGTTCAGGG - Intergenic
1066492680 10:35908661-35908683 TCTCAGATCCAGATATTTGTGGG - Intergenic
1067673148 10:48344729-48344751 TTCCAAATGCATATAGTTCTTGG + Intronic
1071035833 10:81244102-81244124 TCTCACATGCAGAAAGGTCAAGG - Intergenic
1071880949 10:89897830-89897852 TCTTACAAGCATAAAGTTCTGGG + Intergenic
1074751333 10:116590212-116590234 GCACACCTGCAGATAATTCTTGG - Intergenic
1075543035 10:123331332-123331354 TCTCACTTACAGATAGTACCTGG - Intergenic
1079763164 11:24356449-24356471 TCCCACAAGCAGAAAGTTTTGGG + Intergenic
1079974591 11:27075994-27076016 TCCCACCAGCAGAAAGTTCTGGG + Intronic
1086004621 11:82023661-82023683 TTTCCCATGCAGATAGATATAGG - Intergenic
1086113465 11:83222870-83222892 TGGCACATGCATATAGTCCTAGG - Intronic
1089238934 11:117057789-117057811 TATAAGATGCAGATAATTCTAGG + Intronic
1095375532 12:41523667-41523689 TCTCAGATGAAGATAGTGTTAGG + Intronic
1096863551 12:54547840-54547862 TCTCAGATGCAGCCATTTCTTGG + Exonic
1096897629 12:54839946-54839968 TTTCACAAGCAGAAAGTTCTGGG + Intronic
1097596266 12:61636086-61636108 ACCCCCATGCATATAGTTCTAGG + Intergenic
1097908611 12:64946048-64946070 TTTCACATGCAGGTAGTCCCTGG - Intergenic
1098045384 12:66395242-66395264 TCTGACATGCTTAAAGTTCTTGG + Intronic
1098267850 12:68740613-68740635 TCTCACATGAAGATACTTTTAGG + Intronic
1099094017 12:78350629-78350651 TCTCACATGCTGAAAGTGCTTGG + Intergenic
1099161997 12:79253398-79253420 TCTCATATGGGCATAGTTCTTGG - Intronic
1104741375 12:131177235-131177257 TCCCACAAGCAGAAAATTCTGGG - Intergenic
1105657763 13:22458984-22459006 TCTCTCATGAAAATAGTTGTGGG + Intergenic
1106565304 13:30879647-30879669 TTACACATGCCGATAGCTCTTGG - Intergenic
1108681691 13:52786254-52786276 TCACACATCCAGTTGGTTCTCGG + Intergenic
1120486369 14:85118628-85118650 GCACAAATTCAGATAGTTCTTGG + Intergenic
1122129433 14:99596584-99596606 CCTCACAGGCAGAGGGTTCTGGG - Intronic
1123954931 15:25325324-25325346 TTTCAGATGCAGACTGTTCTTGG + Intergenic
1127021304 15:54751504-54751526 TCTCACATGCAGACACATATAGG + Intergenic
1127592773 15:60443529-60443551 TCTCACATGCACGTAGTTCAAGG - Intronic
1128186227 15:65645418-65645440 TCTCATCTGCAGATAGGTCAGGG + Intronic
1128573559 15:68753674-68753696 TCTCAAAGGGAAATAGTTCTTGG + Intergenic
1128699984 15:69797112-69797134 TCTTCCAAGCAGGTAGTTCTAGG + Intergenic
1131304953 15:91234179-91234201 TCTAACATGCAAATATTCCTAGG - Intronic
1131544529 15:93305089-93305111 TCTGACATTCTGATAGTTCTGGG + Intergenic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1136162448 16:28429367-28429389 TCTCATATGCAGGCAATTCTAGG + Intergenic
1136200518 16:28685622-28685644 TCTCATATGCAGGCAATTCTAGG - Intergenic
1136216863 16:28799815-28799837 TCTCATATGCAGGCAATTCTAGG - Intergenic
1138251296 16:55503829-55503851 TCTCACCTTCAGATAATTATTGG + Intronic
1140225662 16:73074645-73074667 TCCAAGATGAAGATAGTTCTGGG + Intergenic
1140975527 16:80056512-80056534 TCTCACATTCAGAAGCTTCTAGG - Intergenic
1141165095 16:81655041-81655063 TCTCATATGCATAAAGTGCTTGG + Intronic
1143811962 17:9479081-9479103 TCACACATGCAGCTGGTACTTGG + Intronic
1144642066 17:16943104-16943126 TCTGTCATGCAGATGGTGCTGGG - Intronic
1145891021 17:28415793-28415815 TCTCACCTGCTGAAACTTCTGGG - Intergenic
1146428841 17:32771137-32771159 TCCCACATGAATATAGTTGTAGG + Exonic
1147551100 17:41442354-41442376 TTCCACATTCAGATAGTTCTTGG + Intergenic
1148189429 17:45668259-45668281 TCTCCCATGCAGCAAGTACTTGG + Intergenic
1150872582 17:68929952-68929974 ACACACATGCACATTGTTCTGGG + Intronic
1151883475 17:76909398-76909420 ATTCACATGCAAACAGTTCTGGG - Intronic
1155453457 18:25986723-25986745 TCTCACATGGAGGTAGTTTGAGG - Intergenic
1155934370 18:31740039-31740061 TATCACATTCAGATAGTTGGGGG - Intergenic
1157063727 18:44322307-44322329 TTTCTCAAGCAGATATTTCTGGG - Intergenic
1157741543 18:50097654-50097676 CCTCACAGGCAGAAAGTTCCAGG + Intronic
1163697891 19:18773185-18773207 TCTCAGGGGCAGATGGTTCTAGG + Intronic
1163773114 19:19202637-19202659 TGTCTCATTCACATAGTTCTTGG + Intronic
1164234199 19:23317919-23317941 TCTCACATGCAGAAAGATATAGG - Intronic
1164248988 19:23460434-23460456 TCTCACATGCAGAAAGATACAGG - Intergenic
1164802851 19:31092026-31092048 TGTCACATTCAGATAGTCCAGGG - Intergenic
929021084 2:37553799-37553821 TCTAATAGGCAAATAGTTCTAGG + Intergenic
929990863 2:46785145-46785167 TCTCTCATGTATATAGTCCTGGG - Intergenic
930912742 2:56649506-56649528 TCTCACATGCACACACTCCTAGG - Intergenic
931961823 2:67490985-67491007 TCTCACTTGGAGATGCTTCTGGG - Intergenic
935663897 2:105493748-105493770 TCCCACATGGGGATAGTCCTCGG - Intergenic
935701202 2:105813515-105813537 TCTCAGATGCTGATAGTTGGAGG + Intronic
935828691 2:106976852-106976874 CCCCACATGCAGGAAGTTCTTGG + Intergenic
936900923 2:117481296-117481318 TCCCACAAGCAAAAAGTTCTGGG + Intergenic
937032379 2:118751532-118751554 ACTCACACGCACATAGTTCTGGG + Intergenic
941555309 2:166972137-166972159 TCTCACATGCAGAGAGTGAGAGG - Intronic
942185213 2:173418720-173418742 TTTCATATGCAGATAATTTTGGG - Intergenic
942217734 2:173738618-173738640 TCTCACCCACAGAAAGTTCTAGG - Intergenic
942694271 2:178621839-178621861 TCTGGCATGCTGACAGTTCTGGG - Exonic
943006852 2:182395545-182395567 TCCCAAATCCAGATAGTTGTAGG - Intronic
943320982 2:186442237-186442259 TATCACATGCTAATATTTCTAGG + Intergenic
1172224981 20:33299452-33299474 TCCCCCATGCAGGTGGTTCTGGG - Intronic
1172381198 20:34493903-34493925 CCCTACATGCAGATGGTTCTAGG - Intronic
1174849618 20:53979714-53979736 AATCCCATCCAGATAGTTCTAGG - Intronic
1176139590 20:63539142-63539164 TCTCCCATGCAGATGGAGCTGGG + Intergenic
1177467462 21:21506119-21506141 TCTCACATGCAGATAGTTCTAGG - Intronic
1180165550 21:46024076-46024098 GTCCACATGCAGATATTTCTGGG - Intergenic
1183238548 22:36638579-36638601 TCTCACTTGGAGAGAGTTCTTGG + Intronic
1185059234 22:48597421-48597443 GCTCACATGCAGAGTGTCCTGGG + Intronic
950695869 3:14700886-14700908 CCTCACCTGCTGACAGTTCTGGG + Intronic
951066851 3:18276859-18276881 TCCGACCTGCAGATAGTTCTGGG - Intronic
951919426 3:27838131-27838153 TGTCACATGCCTATAGTCCTAGG - Intergenic
952700261 3:36320334-36320356 TGTCACAGTCAGATTGTTCTGGG + Intergenic
955443191 3:58978802-58978824 TTTCTAATGCAGATAGTTCAAGG + Intronic
955578769 3:60396085-60396107 TGTCACATGGGGGTAGTTCTGGG - Intronic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
960472488 3:118084546-118084568 TACCACATACAGAAAGTTCTGGG + Intergenic
965093219 3:164188176-164188198 TCTTACATGCACATCTTTCTGGG + Intergenic
965921460 3:173920468-173920490 TCACAGGTGCAGATTGTTCTTGG + Intronic
966168953 3:177055611-177055633 ACTCATATTCAGATAGTTGTGGG - Intronic
970443488 4:16105200-16105222 TGTCACATTCAGATAGATCCAGG - Intergenic
975396577 4:73881297-73881319 TCTTACACTCAGATATTTCTAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
979664243 4:123293357-123293379 TCCCACAAGCAGAAAGTTCTAGG + Intronic
993176556 5:84494163-84494185 TCTAATATACAAATAGTTCTTGG - Intergenic
994789406 5:104205268-104205290 TCTCAGGTGCAAATAGTTCATGG - Intergenic
995115406 5:108472780-108472802 TCCCACAAGCAGAAAGTTCTGGG - Intergenic
996660879 5:126001296-126001318 TCTTTCATCCAGATATTTCTGGG + Intergenic
996718095 5:126603558-126603580 TTTCACTTGCAGAAAGTGCTAGG + Exonic
997265807 5:132494795-132494817 TCTCAGATACAGACATTTCTTGG + Intergenic
1000202316 5:159023604-159023626 TGTAACATGCAGATAGTGATTGG + Intronic
1000204725 5:159047929-159047951 TCTGAAATGCAGACAGTTCTGGG - Intronic
1002032387 5:176439980-176440002 TGGCACATGCTGATAGTCCTGGG - Intergenic
1005100724 6:22170250-22170272 TCTCACATGCAGAGACACCTAGG - Intergenic
1006258266 6:32848220-32848242 TCCCACATGCACAGATTTCTGGG + Intronic
1010274761 6:73956600-73956622 ACTCACACCCAAATAGTTCTGGG - Intergenic
1012084144 6:94802030-94802052 TCTCATATGGACACAGTTCTTGG - Intergenic
1012906062 6:105067459-105067481 TCTCACATGCAGTGGGTACTCGG - Intronic
1012953121 6:105540164-105540186 TCTTAGAGGCAAATAGTTCTGGG + Intergenic
1016490287 6:144592901-144592923 TCTGAAATTCAGACAGTTCTGGG - Intronic
1021582127 7:22167220-22167242 TCTGCCATGCACATGGTTCTGGG - Intronic
1026395736 7:69952331-69952353 TTCCAAATGCAGATAGTTCATGG + Intronic
1028017701 7:85736086-85736108 TCCCACAAGCAGAAAGTTCTGGG - Intergenic
1028808155 7:95053026-95053048 TCACACAGGAAGATTGTTCTGGG - Intronic
1029175012 7:98658395-98658417 TCTGAAATTCAGATATTTCTGGG - Intergenic
1031852746 7:126885341-126885363 TCTTACCTGAAGAAAGTTCTGGG - Intronic
1033709961 7:143932758-143932780 TCTGAAATGCAGGTATTTCTGGG + Intergenic
1035528525 8:333420-333442 TCACACATTCAAAAAGTTCTTGG - Intergenic
1036448567 8:8844915-8844937 TTTGTCATGCAGATAGTTTTGGG - Intronic
1036501557 8:9319228-9319250 TCTGACAGGCAGATAGGCCTGGG + Intergenic
1037003154 8:13746114-13746136 TCAAACATGCAGATAATCCTGGG + Intergenic
1037447696 8:18983656-18983678 TCTTACATGGACACAGTTCTTGG + Intronic
1038765872 8:30427190-30427212 TTTCAAATGCAAATAATTCTGGG - Intronic
1039198505 8:35060118-35060140 TCCCACAAGCAGAAAGATCTGGG + Intergenic
1040823036 8:51585988-51586010 TGTCACATTCATATAGGTCTGGG - Intronic
1041933838 8:63315270-63315292 TCTCCCAGGCAGATATTTCATGG - Intergenic
1043704735 8:83333991-83334013 TGTCACATGCCTATAATTCTGGG + Intergenic
1044177752 8:89151161-89151183 TTTTACTTGCAGATATTTCTAGG + Intergenic
1044447377 8:92295005-92295027 TCTCACATGCAGATACACATAGG - Intergenic
1044585492 8:93865723-93865745 TTTGAAATGCAGATAGTTCAAGG + Intronic
1044880190 8:96715699-96715721 TCCCACAAGCAGAAAGTTCTGGG + Intronic
1045874792 8:106967137-106967159 TCTCACATGCAAATTTCTCTAGG + Intergenic
1047342244 8:123993589-123993611 TCCCACCAGCAGAAAGTTCTGGG + Intronic
1047384248 8:124394919-124394941 TCTCACAAGCAGAAAGTTCTGGG + Intergenic
1047444562 8:124907692-124907714 TCTCACTTGCAAATAGGTCCTGG - Intergenic
1048224222 8:132569229-132569251 ACTGAAATGCAGATAATTCTTGG + Intergenic
1051388333 9:16535884-16535906 GTTCACCTGCAGATAGTTGTAGG - Intronic
1052716073 9:32118950-32118972 TCTCACAGTCATACAGTTCTAGG - Intergenic
1053559043 9:39170554-39170576 TCTCACATGCAGTCAGATGTGGG - Intronic
1053823163 9:41990795-41990817 TCTCACATGCAGTCAGATGTGGG - Intronic
1054138068 9:61448392-61448414 TCTCACATGCAGTCAGATGTGGG + Intergenic
1054607410 9:67196570-67196592 TCTCACATGCAGTCAGATGTGGG + Intergenic
1055489443 9:76789766-76789788 TCTCACATCCTGAAAGTCCTGGG + Intronic
1056556717 9:87695512-87695534 TCTAATCTGCAGATATTTCTGGG + Intronic
1058638274 9:107057819-107057841 TACCACATGTTGATAGTTCTGGG + Intergenic
1058974390 9:110112571-110112593 AAGCACATGCAAATAGTTCTAGG + Intronic
1060317130 9:122522568-122522590 ACACACATGCACACAGTTCTTGG - Intergenic
1186886774 X:13921911-13921933 TATTACATGCAGAAATTTCTAGG + Intronic
1187269182 X:17764615-17764637 TCTGACATTCAGAGGGTTCTTGG - Intergenic
1187320335 X:18232048-18232070 TCTGACATTCAGAGGGTTCTTGG + Intergenic
1189095318 X:38132230-38132252 TCTCACTTTCAGATGCTTCTAGG - Intronic
1192682664 X:73267927-73267949 TCCCACAAGCAGAAAGTTATGGG - Intergenic
1192727179 X:73765713-73765735 TCCCACAAGCAGAAAGTTCAGGG + Intergenic
1199065904 X:143417967-143417989 TCCCACCAGCAGAAAGTTCTGGG + Intergenic
1199170264 X:144726870-144726892 TCCCACCAGCAGAAAGTTCTGGG - Intergenic