ID: 1177470073

View in Genome Browser
Species Human (GRCh38)
Location 21:21548943-21548965
Sequence CTACTTCAGCCCATTTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177470073_1177470074 -8 Left 1177470073 21:21548943-21548965 CCTATTTAAATGGGCTGAAGTAG No data
Right 1177470074 21:21548958-21548980 TGAAGTAGCATACTAAACTGTGG No data
1177470073_1177470075 17 Left 1177470073 21:21548943-21548965 CCTATTTAAATGGGCTGAAGTAG No data
Right 1177470075 21:21548983-21549005 TGTGTTGCATTCACAATCTAAGG No data
1177470073_1177470076 29 Left 1177470073 21:21548943-21548965 CCTATTTAAATGGGCTGAAGTAG No data
Right 1177470076 21:21548995-21549017 ACAATCTAAGGAAGCCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177470073 Original CRISPR CTACTTCAGCCCATTTAAAT AGG (reversed) Intergenic
No off target data available for this crispr