ID: 1177475648

View in Genome Browser
Species Human (GRCh38)
Location 21:21618285-21618307
Sequence GCTACTTTTGCCTCAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177475648_1177475649 10 Left 1177475648 21:21618285-21618307 CCTGCTTCTGAGGCAAAAGTAGC No data
Right 1177475649 21:21618318-21618340 TTCCTATTTTAGCAACTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177475648 Original CRISPR GCTACTTTTGCCTCAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr