ID: 1177478154

View in Genome Browser
Species Human (GRCh38)
Location 21:21651070-21651092
Sequence GTCACTTCTGTGTACCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177478154_1177478161 15 Left 1177478154 21:21651070-21651092 CCCTGCTGGTACACAGAAGTGAC No data
Right 1177478161 21:21651108-21651130 AACCTCCGCCTACATTTCAGAGG No data
1177478154_1177478159 -9 Left 1177478154 21:21651070-21651092 CCCTGCTGGTACACAGAAGTGAC No data
Right 1177478159 21:21651084-21651106 AGAAGTGACGAATTGGGGTTTGG No data
1177478154_1177478165 23 Left 1177478154 21:21651070-21651092 CCCTGCTGGTACACAGAAGTGAC No data
Right 1177478165 21:21651116-21651138 CCTACATTTCAGAGGATGTATGG No data
1177478154_1177478160 -8 Left 1177478154 21:21651070-21651092 CCCTGCTGGTACACAGAAGTGAC No data
Right 1177478160 21:21651085-21651107 GAAGTGACGAATTGGGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177478154 Original CRISPR GTCACTTCTGTGTACCAGCA GGG (reversed) Intergenic