ID: 1177478155

View in Genome Browser
Species Human (GRCh38)
Location 21:21651071-21651093
Sequence CGTCACTTCTGTGTACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177478155_1177478159 -10 Left 1177478155 21:21651071-21651093 CCTGCTGGTACACAGAAGTGACG No data
Right 1177478159 21:21651084-21651106 AGAAGTGACGAATTGGGGTTTGG No data
1177478155_1177478165 22 Left 1177478155 21:21651071-21651093 CCTGCTGGTACACAGAAGTGACG No data
Right 1177478165 21:21651116-21651138 CCTACATTTCAGAGGATGTATGG 0: 27
1: 1330
2: 2166
3: 1582
4: 915
1177478155_1177478161 14 Left 1177478155 21:21651071-21651093 CCTGCTGGTACACAGAAGTGACG No data
Right 1177478161 21:21651108-21651130 AACCTCCGCCTACATTTCAGAGG No data
1177478155_1177478160 -9 Left 1177478155 21:21651071-21651093 CCTGCTGGTACACAGAAGTGACG No data
Right 1177478160 21:21651085-21651107 GAAGTGACGAATTGGGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177478155 Original CRISPR CGTCACTTCTGTGTACCAGC AGG (reversed) Intergenic
No off target data available for this crispr