ID: 1177478159

View in Genome Browser
Species Human (GRCh38)
Location 21:21651084-21651106
Sequence AGAAGTGACGAATTGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177478152_1177478159 17 Left 1177478152 21:21651044-21651066 CCTTGGCAGCTTCTATATGGTGT No data
Right 1177478159 21:21651084-21651106 AGAAGTGACGAATTGGGGTTTGG No data
1177478155_1177478159 -10 Left 1177478155 21:21651071-21651093 CCTGCTGGTACACAGAAGTGACG No data
Right 1177478159 21:21651084-21651106 AGAAGTGACGAATTGGGGTTTGG No data
1177478149_1177478159 23 Left 1177478149 21:21651038-21651060 CCCAAGCCTTGGCAGCTTCTATA No data
Right 1177478159 21:21651084-21651106 AGAAGTGACGAATTGGGGTTTGG No data
1177478150_1177478159 22 Left 1177478150 21:21651039-21651061 CCAAGCCTTGGCAGCTTCTATAT No data
Right 1177478159 21:21651084-21651106 AGAAGTGACGAATTGGGGTTTGG No data
1177478154_1177478159 -9 Left 1177478154 21:21651070-21651092 CCCTGCTGGTACACAGAAGTGAC No data
Right 1177478159 21:21651084-21651106 AGAAGTGACGAATTGGGGTTTGG No data
1177478148_1177478159 24 Left 1177478148 21:21651037-21651059 CCCCAAGCCTTGGCAGCTTCTAT 0: 36
1: 552
2: 1408
3: 1482
4: 1364
Right 1177478159 21:21651084-21651106 AGAAGTGACGAATTGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177478159 Original CRISPR AGAAGTGACGAATTGGGGTT TGG Intergenic
No off target data available for this crispr