ID: 1177478161

View in Genome Browser
Species Human (GRCh38)
Location 21:21651108-21651130
Sequence AACCTCCGCCTACATTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177478154_1177478161 15 Left 1177478154 21:21651070-21651092 CCCTGCTGGTACACAGAAGTGAC No data
Right 1177478161 21:21651108-21651130 AACCTCCGCCTACATTTCAGAGG No data
1177478155_1177478161 14 Left 1177478155 21:21651071-21651093 CCTGCTGGTACACAGAAGTGACG No data
Right 1177478161 21:21651108-21651130 AACCTCCGCCTACATTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177478161 Original CRISPR AACCTCCGCCTACATTTCAG AGG Intergenic
No off target data available for this crispr