ID: 1177478165

View in Genome Browser
Species Human (GRCh38)
Location 21:21651116-21651138
Sequence CCTACATTTCAGAGGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6020
Summary {0: 27, 1: 1330, 2: 2166, 3: 1582, 4: 915}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177478154_1177478165 23 Left 1177478154 21:21651070-21651092 CCCTGCTGGTACACAGAAGTGAC No data
Right 1177478165 21:21651116-21651138 CCTACATTTCAGAGGATGTATGG 0: 27
1: 1330
2: 2166
3: 1582
4: 915
1177478155_1177478165 22 Left 1177478155 21:21651071-21651093 CCTGCTGGTACACAGAAGTGACG No data
Right 1177478165 21:21651116-21651138 CCTACATTTCAGAGGATGTATGG 0: 27
1: 1330
2: 2166
3: 1582
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177478165 Original CRISPR CCTACATTTCAGAGGATGTA TGG Intergenic
Too many off-targets to display for this crispr