ID: 1177479807

View in Genome Browser
Species Human (GRCh38)
Location 21:21671603-21671625
Sequence TAAGATAACCAAATTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177479801_1177479807 18 Left 1177479801 21:21671562-21671584 CCTTATAAGTCTTTGTTTTAACA No data
Right 1177479807 21:21671603-21671625 TAAGATAACCAAATTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177479807 Original CRISPR TAAGATAACCAAATTGGGGT GGG Intergenic
No off target data available for this crispr