ID: 1177481950

View in Genome Browser
Species Human (GRCh38)
Location 21:21701489-21701511
Sequence GCAGCTGGTAAGATAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177481950_1177481953 16 Left 1177481950 21:21701489-21701511 CCTGTTTTTATCTTACCAGCTGC No data
Right 1177481953 21:21701528-21701550 TTTAGAGTCAATTCTCAGACTGG No data
1177481950_1177481952 -8 Left 1177481950 21:21701489-21701511 CCTGTTTTTATCTTACCAGCTGC No data
Right 1177481952 21:21701504-21701526 CCAGCTGCTGCTTCTTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177481950 Original CRISPR GCAGCTGGTAAGATAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr