ID: 1177482872

View in Genome Browser
Species Human (GRCh38)
Location 21:21714810-21714832
Sequence GTAACTAGTGAGATTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177482870_1177482872 6 Left 1177482870 21:21714781-21714803 CCTGTGTTTTATTGGCAAAAGCA No data
Right 1177482872 21:21714810-21714832 GTAACTAGTGAGATTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177482872 Original CRISPR GTAACTAGTGAGATTCAGGA AGG Intergenic
No off target data available for this crispr