ID: 1177483720

View in Genome Browser
Species Human (GRCh38)
Location 21:21728021-21728043
Sequence AGTTCAGCAGCCTCTTTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177483720_1177483722 24 Left 1177483720 21:21728021-21728043 CCGCTGAAAGAGGCTGCTGAACT No data
Right 1177483722 21:21728068-21728090 TGTGCTTTGTTTAGTGATGCTGG No data
1177483720_1177483723 25 Left 1177483720 21:21728021-21728043 CCGCTGAAAGAGGCTGCTGAACT No data
Right 1177483723 21:21728069-21728091 GTGCTTTGTTTAGTGATGCTGGG No data
1177483720_1177483721 -5 Left 1177483720 21:21728021-21728043 CCGCTGAAAGAGGCTGCTGAACT No data
Right 1177483721 21:21728039-21728061 GAACTTGAAGCTATTATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177483720 Original CRISPR AGTTCAGCAGCCTCTTTCAG CGG (reversed) Intergenic
No off target data available for this crispr