ID: 1177495305

View in Genome Browser
Species Human (GRCh38)
Location 21:21881616-21881638
Sequence GTTTCAACACAGATACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177495301_1177495305 22 Left 1177495301 21:21881571-21881593 CCTTTGTACTAGATAACAAATGT No data
Right 1177495305 21:21881616-21881638 GTTTCAACACAGATACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177495305 Original CRISPR GTTTCAACACAGATACTGGA AGG Intergenic
No off target data available for this crispr