ID: 1177504766

View in Genome Browser
Species Human (GRCh38)
Location 21:22006200-22006222
Sequence CACCTTGTTGTTGCATCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177504765_1177504766 -1 Left 1177504765 21:22006178-22006200 CCTGGTCTTTGCTCTAAGATGGC No data
Right 1177504766 21:22006200-22006222 CACCTTGTTGTTGCATCCTTTGG No data
1177504763_1177504766 10 Left 1177504763 21:22006167-22006189 CCTGGTGAGGGCCTGGTCTTTGC No data
Right 1177504766 21:22006200-22006222 CACCTTGTTGTTGCATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177504766 Original CRISPR CACCTTGTTGTTGCATCCTT TGG Intergenic
No off target data available for this crispr