ID: 1177505560

View in Genome Browser
Species Human (GRCh38)
Location 21:22014173-22014195
Sequence GACAGCTTTTGGCCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177505560_1177505564 15 Left 1177505560 21:22014173-22014195 CCAGTAGCAGGCCAAAAGCTGTC No data
Right 1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG 0: 5
1: 198
2: 191
3: 123
4: 339
1177505560_1177505563 11 Left 1177505560 21:22014173-22014195 CCAGTAGCAGGCCAAAAGCTGTC No data
Right 1177505563 21:22014207-22014229 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
1177505560_1177505565 16 Left 1177505560 21:22014173-22014195 CCAGTAGCAGGCCAAAAGCTGTC No data
Right 1177505565 21:22014212-22014234 GTTATCTGCAGAAGATGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177505560 Original CRISPR GACAGCTTTTGGCCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr