ID: 1177510425

View in Genome Browser
Species Human (GRCh38)
Location 21:22079890-22079912
Sequence GTGCATATCAGAGAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177510425_1177510427 4 Left 1177510425 21:22079890-22079912 CCTTCCTGCTCTCTGATATGCAC No data
Right 1177510427 21:22079917-22079939 TTTTTGTTAAGCAATAGACTCGG No data
1177510425_1177510428 27 Left 1177510425 21:22079890-22079912 CCTTCCTGCTCTCTGATATGCAC No data
Right 1177510428 21:22079940-22079962 AAATTTGAGCTTTCAATAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177510425 Original CRISPR GTGCATATCAGAGAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr