ID: 1177513761

View in Genome Browser
Species Human (GRCh38)
Location 21:22121985-22122007
Sequence CCCTCCAACCCTGCTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177513752_1177513761 8 Left 1177513752 21:22121954-22121976 CCCAGAGGTTCCCCCAGAAGAGG No data
Right 1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG No data
1177513758_1177513761 -5 Left 1177513758 21:22121967-22121989 CCAGAAGAGGAGCCAGCTCCCTC No data
Right 1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG No data
1177513757_1177513761 -4 Left 1177513757 21:22121966-22121988 CCCAGAAGAGGAGCCAGCTCCCT No data
Right 1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG No data
1177513756_1177513761 -3 Left 1177513756 21:22121965-22121987 CCCCAGAAGAGGAGCCAGCTCCC No data
Right 1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG No data
1177513755_1177513761 -2 Left 1177513755 21:22121964-22121986 CCCCCAGAAGAGGAGCCAGCTCC No data
Right 1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG No data
1177513754_1177513761 7 Left 1177513754 21:22121955-22121977 CCAGAGGTTCCCCCAGAAGAGGA No data
Right 1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG No data
1177513751_1177513761 9 Left 1177513751 21:22121953-22121975 CCCCAGAGGTTCCCCCAGAAGAG No data
Right 1177513761 21:22121985-22122007 CCCTCCAACCCTGCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177513761 Original CRISPR CCCTCCAACCCTGCTCCTTC AGG Intergenic
No off target data available for this crispr