ID: 1177517468

View in Genome Browser
Species Human (GRCh38)
Location 21:22174426-22174448
Sequence GGAGCAGGCATGATACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177517468_1177517474 13 Left 1177517468 21:22174426-22174448 CCACCATGTATCATGCCTGCTCC No data
Right 1177517474 21:22174462-22174484 TCATGAGTAAAAGCTTCCTGAGG 0: 7
1: 237
2: 630
3: 1323
4: 4188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177517468 Original CRISPR GGAGCAGGCATGATACATGG TGG (reversed) Intergenic
No off target data available for this crispr