ID: 1177519464

View in Genome Browser
Species Human (GRCh38)
Location 21:22200205-22200227
Sequence CACACTGGGAGGACTTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177519464_1177519475 28 Left 1177519464 21:22200205-22200227 CCTCTCCAAGTCCTCCCAGTGTG No data
Right 1177519475 21:22200256-22200278 TAGCCTAGCCAGAGATTCATGGG No data
1177519464_1177519472 -5 Left 1177519464 21:22200205-22200227 CCTCTCCAAGTCCTCCCAGTGTG No data
Right 1177519472 21:22200223-22200245 GTGTGGCCTCATATGGGAGAAGG No data
1177519464_1177519474 27 Left 1177519464 21:22200205-22200227 CCTCTCCAAGTCCTCCCAGTGTG No data
Right 1177519474 21:22200255-22200277 TTAGCCTAGCCAGAGATTCATGG No data
1177519464_1177519476 29 Left 1177519464 21:22200205-22200227 CCTCTCCAAGTCCTCCCAGTGTG No data
Right 1177519476 21:22200257-22200279 AGCCTAGCCAGAGATTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177519464 Original CRISPR CACACTGGGAGGACTTGGAG AGG (reversed) Intergenic
No off target data available for this crispr