ID: 1177519732

View in Genome Browser
Species Human (GRCh38)
Location 21:22204091-22204113
Sequence CCCTGAGGACTTAATGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177519728_1177519732 23 Left 1177519728 21:22204045-22204067 CCAGATTATTACAGCAGAGGTTA No data
Right 1177519732 21:22204091-22204113 CCCTGAGGACTTAATGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177519732 Original CRISPR CCCTGAGGACTTAATGAACG TGG Intergenic
No off target data available for this crispr