ID: 1177534067

View in Genome Browser
Species Human (GRCh38)
Location 21:22401693-22401715
Sequence ATGCCCTTTTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177534067_1177534069 2 Left 1177534067 21:22401693-22401715 CCTTCACTCTTCTAAAAGGGCAT No data
Right 1177534069 21:22401718-22401740 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177534067 Original CRISPR ATGCCCTTTTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr