ID: 1177535109

View in Genome Browser
Species Human (GRCh38)
Location 21:22415655-22415677
Sequence TTGACTTTGAGCAAAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177535109_1177535111 -4 Left 1177535109 21:22415655-22415677 CCTGAAATTTTGCTCAAAGTCAA No data
Right 1177535111 21:22415674-22415696 TCAATTTAATTTTCTTACATGGG No data
1177535109_1177535110 -5 Left 1177535109 21:22415655-22415677 CCTGAAATTTTGCTCAAAGTCAA No data
Right 1177535110 21:22415673-22415695 GTCAATTTAATTTTCTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177535109 Original CRISPR TTGACTTTGAGCAAAATTTC AGG (reversed) Intergenic
No off target data available for this crispr