ID: 1177545557

View in Genome Browser
Species Human (GRCh38)
Location 21:22553239-22553261
Sequence GTGAGGAATGGGTCAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177545549_1177545557 8 Left 1177545549 21:22553208-22553230 CCACCACACCCGGCCAAGATGTG No data
Right 1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG No data
1177545550_1177545557 5 Left 1177545550 21:22553211-22553233 CCACACCCGGCCAAGATGTGTTT No data
Right 1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG No data
1177545553_1177545557 -5 Left 1177545553 21:22553221-22553243 CCAAGATGTGTTTTAAAAGTGAG No data
Right 1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG No data
1177545551_1177545557 0 Left 1177545551 21:22553216-22553238 CCCGGCCAAGATGTGTTTTAAAA No data
Right 1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG No data
1177545552_1177545557 -1 Left 1177545552 21:22553217-22553239 CCGGCCAAGATGTGTTTTAAAAG No data
Right 1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177545557 Original CRISPR GTGAGGAATGGGTCAGATTA TGG Intergenic
No off target data available for this crispr