ID: 1177546245

View in Genome Browser
Species Human (GRCh38)
Location 21:22562151-22562173
Sequence CACCAAAGGCGAGCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177546245_1177546251 -4 Left 1177546245 21:22562151-22562173 CCGCACCTGGCTCGCCTTTGGTG No data
Right 1177546251 21:22562170-22562192 GGTGGGTGTGAGATCCAGGCCGG No data
1177546245_1177546250 -8 Left 1177546245 21:22562151-22562173 CCGCACCTGGCTCGCCTTTGGTG No data
Right 1177546250 21:22562166-22562188 CTTTGGTGGGTGTGAGATCCAGG No data
1177546245_1177546253 -2 Left 1177546245 21:22562151-22562173 CCGCACCTGGCTCGCCTTTGGTG No data
Right 1177546253 21:22562172-22562194 TGGGTGTGAGATCCAGGCCGGGG No data
1177546245_1177546256 17 Left 1177546245 21:22562151-22562173 CCGCACCTGGCTCGCCTTTGGTG No data
Right 1177546256 21:22562191-22562213 GGGGCGCAAGCCATGCTCAGCGG No data
1177546245_1177546257 22 Left 1177546245 21:22562151-22562173 CCGCACCTGGCTCGCCTTTGGTG No data
Right 1177546257 21:22562196-22562218 GCAAGCCATGCTCAGCGGACTGG No data
1177546245_1177546252 -3 Left 1177546245 21:22562151-22562173 CCGCACCTGGCTCGCCTTTGGTG No data
Right 1177546252 21:22562171-22562193 GTGGGTGTGAGATCCAGGCCGGG No data
1177546245_1177546258 23 Left 1177546245 21:22562151-22562173 CCGCACCTGGCTCGCCTTTGGTG No data
Right 1177546258 21:22562197-22562219 CAAGCCATGCTCAGCGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177546245 Original CRISPR CACCAAAGGCGAGCCAGGTG CGG (reversed) Intergenic
No off target data available for this crispr