ID: 1177552500 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:22643869-22643891 |
| Sequence | TCTCAGATTTAGTATGTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177552500_1177552502 | 8 | Left | 1177552500 | 21:22643869-22643891 | CCATCCACATACTAAATCTGAGA | No data | ||
| Right | 1177552502 | 21:22643900-22643922 | CATTCTAATGCTATTGAGCAAGG | No data | ||||
| 1177552500_1177552504 | 24 | Left | 1177552500 | 21:22643869-22643891 | CCATCCACATACTAAATCTGAGA | No data | ||
| Right | 1177552504 | 21:22643916-22643938 | AGCAAGGAGCTTCAAAGGACAGG | No data | ||||
| 1177552500_1177552503 | 19 | Left | 1177552500 | 21:22643869-22643891 | CCATCCACATACTAAATCTGAGA | No data | ||
| Right | 1177552503 | 21:22643911-22643933 | TATTGAGCAAGGAGCTTCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177552500 | Original CRISPR | TCTCAGATTTAGTATGTGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||