ID: 1177552500

View in Genome Browser
Species Human (GRCh38)
Location 21:22643869-22643891
Sequence TCTCAGATTTAGTATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177552500_1177552502 8 Left 1177552500 21:22643869-22643891 CCATCCACATACTAAATCTGAGA No data
Right 1177552502 21:22643900-22643922 CATTCTAATGCTATTGAGCAAGG No data
1177552500_1177552504 24 Left 1177552500 21:22643869-22643891 CCATCCACATACTAAATCTGAGA No data
Right 1177552504 21:22643916-22643938 AGCAAGGAGCTTCAAAGGACAGG No data
1177552500_1177552503 19 Left 1177552500 21:22643869-22643891 CCATCCACATACTAAATCTGAGA No data
Right 1177552503 21:22643911-22643933 TATTGAGCAAGGAGCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177552500 Original CRISPR TCTCAGATTTAGTATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr