ID: 1177558404

View in Genome Browser
Species Human (GRCh38)
Location 21:22719584-22719606
Sequence GGTCACCTGGGTCCAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177558396_1177558404 -2 Left 1177558396 21:22719563-22719585 CCCCATATGCTTCCTTGAACTGG No data
Right 1177558404 21:22719584-22719606 GGTCACCTGGGTCCAAGGAATGG No data
1177558399_1177558404 -4 Left 1177558399 21:22719565-22719587 CCATATGCTTCCTTGAACTGGTC No data
Right 1177558404 21:22719584-22719606 GGTCACCTGGGTCCAAGGAATGG No data
1177558398_1177558404 -3 Left 1177558398 21:22719564-22719586 CCCATATGCTTCCTTGAACTGGT No data
Right 1177558404 21:22719584-22719606 GGTCACCTGGGTCCAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177558404 Original CRISPR GGTCACCTGGGTCCAAGGAA TGG Intergenic
No off target data available for this crispr