ID: 1177567400

View in Genome Browser
Species Human (GRCh38)
Location 21:22843234-22843256
Sequence GAGGGGCAAATGATAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177567400_1177567405 17 Left 1177567400 21:22843234-22843256 CCTGCCTCTATCATTTGCCCCTC No data
Right 1177567405 21:22843274-22843296 CTGCTGTTAGAATAAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177567400 Original CRISPR GAGGGGCAAATGATAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr