ID: 1177567405

View in Genome Browser
Species Human (GRCh38)
Location 21:22843274-22843296
Sequence CTGCTGTTAGAATAAAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177567403_1177567405 -1 Left 1177567403 21:22843252-22843274 CCCTCAAAAGAAGTGCATATAAC No data
Right 1177567405 21:22843274-22843296 CTGCTGTTAGAATAAAGATAAGG No data
1177567401_1177567405 13 Left 1177567401 21:22843238-22843260 CCTCTATCATTTGCCCCTCAAAA No data
Right 1177567405 21:22843274-22843296 CTGCTGTTAGAATAAAGATAAGG No data
1177567402_1177567405 0 Left 1177567402 21:22843251-22843273 CCCCTCAAAAGAAGTGCATATAA No data
Right 1177567405 21:22843274-22843296 CTGCTGTTAGAATAAAGATAAGG No data
1177567404_1177567405 -2 Left 1177567404 21:22843253-22843275 CCTCAAAAGAAGTGCATATAACT No data
Right 1177567405 21:22843274-22843296 CTGCTGTTAGAATAAAGATAAGG No data
1177567400_1177567405 17 Left 1177567400 21:22843234-22843256 CCTGCCTCTATCATTTGCCCCTC No data
Right 1177567405 21:22843274-22843296 CTGCTGTTAGAATAAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177567405 Original CRISPR CTGCTGTTAGAATAAAGATA AGG Intergenic
No off target data available for this crispr