ID: 1177568349

View in Genome Browser
Species Human (GRCh38)
Location 21:22853159-22853181
Sequence GCTGACATTTGATCAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177568348_1177568349 -10 Left 1177568348 21:22853146-22853168 CCTTGTCTCATAAGCTGACATTT No data
Right 1177568349 21:22853159-22853181 GCTGACATTTGATCAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177568349 Original CRISPR GCTGACATTTGATCAAAGAC TGG Intergenic
No off target data available for this crispr