ID: 1177575787

View in Genome Browser
Species Human (GRCh38)
Location 21:22953700-22953722
Sequence CAATTAGCCCACTTTCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177575782_1177575787 22 Left 1177575782 21:22953655-22953677 CCTAAAAAATCAGCGTTATTCAT No data
Right 1177575787 21:22953700-22953722 CAATTAGCCCACTTTCATATTGG No data
1177575784_1177575787 -6 Left 1177575784 21:22953683-22953705 CCACTCCTGGCAAAATCCAATTA No data
Right 1177575787 21:22953700-22953722 CAATTAGCCCACTTTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177575787 Original CRISPR CAATTAGCCCACTTTCATAT TGG Intergenic
No off target data available for this crispr