ID: 1177576575

View in Genome Browser
Species Human (GRCh38)
Location 21:22964307-22964329
Sequence CATTGTTGCTGAAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177576567_1177576575 24 Left 1177576567 21:22964260-22964282 CCGGTGTGCAGATGGAAGTATTG No data
Right 1177576575 21:22964307-22964329 CATTGTTGCTGAAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177576575 Original CRISPR CATTGTTGCTGAAGGGAAGG GGG Intergenic
No off target data available for this crispr