ID: 1177591681

View in Genome Browser
Species Human (GRCh38)
Location 21:23178635-23178657
Sequence CCAGTAAATAATTTAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177591681_1177591684 -6 Left 1177591681 21:23178635-23178657 CCTGCTTTTAAATTATTTACTGG No data
Right 1177591684 21:23178652-23178674 TACTGGGATAATATCTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177591681 Original CRISPR CCAGTAAATAATTTAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr