ID: 1177594704

View in Genome Browser
Species Human (GRCh38)
Location 21:23223188-23223210
Sequence TAGCCAGTCCAATTTGGTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177594704_1177594707 10 Left 1177594704 21:23223188-23223210 CCGTTACCAAATTGGACTGGCTA No data
Right 1177594707 21:23223221-23223243 TTTGTTAGAATTCAGTTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177594704 Original CRISPR TAGCCAGTCCAATTTGGTAA CGG (reversed) Intergenic
No off target data available for this crispr