ID: 1177594707

View in Genome Browser
Species Human (GRCh38)
Location 21:23223221-23223243
Sequence TTTGTTAGAATTCAGTTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177594704_1177594707 10 Left 1177594704 21:23223188-23223210 CCGTTACCAAATTGGACTGGCTA No data
Right 1177594707 21:23223221-23223243 TTTGTTAGAATTCAGTTAGACGG No data
1177594705_1177594707 4 Left 1177594705 21:23223194-23223216 CCAAATTGGACTGGCTATAAAAT No data
Right 1177594707 21:23223221-23223243 TTTGTTAGAATTCAGTTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177594707 Original CRISPR TTTGTTAGAATTCAGTTAGA CGG Intergenic
No off target data available for this crispr