ID: 1177604557

View in Genome Browser
Species Human (GRCh38)
Location 21:23360804-23360826
Sequence CAAAACGCTGATAGTGATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177604557_1177604560 4 Left 1177604557 21:23360804-23360826 CCCGTATCACTATCAGCGTTTTG No data
Right 1177604560 21:23360831-23360853 AAGCCATTCAACAAGTTTCTAGG 0: 57
1: 1583
2: 1923
3: 1363
4: 877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177604557 Original CRISPR CAAAACGCTGATAGTGATAC GGG (reversed) Intergenic
No off target data available for this crispr