ID: 1177613117

View in Genome Browser
Species Human (GRCh38)
Location 21:23479789-23479811
Sequence CTGTTCACTCAGATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177613117_1177613118 9 Left 1177613117 21:23479789-23479811 CCTGGGGAAATCTGAGTGAACAG No data
Right 1177613118 21:23479821-23479843 AATGAAAATAAGATAATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177613117 Original CRISPR CTGTTCACTCAGATTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr