ID: 1177614660

View in Genome Browser
Species Human (GRCh38)
Location 21:23501141-23501163
Sequence CAACAATTTAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3704
Summary {0: 65, 1: 93, 2: 200, 3: 783, 4: 2563}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177614660_1177614663 3 Left 1177614660 21:23501141-23501163 CCTAGAGACTTGTTAAATTGTTG 0: 65
1: 93
2: 200
3: 783
4: 2563
Right 1177614663 21:23501167-23501189 CCAAAATGCTGGTAGTGATATGG 0: 30
1: 1047
2: 1698
3: 1515
4: 1141
1177614660_1177614664 4 Left 1177614660 21:23501141-23501163 CCTAGAGACTTGTTAAATTGTTG 0: 65
1: 93
2: 200
3: 783
4: 2563
Right 1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG No data
1177614660_1177614665 18 Left 1177614660 21:23501141-23501163 CCTAGAGACTTGTTAAATTGTTG 0: 65
1: 93
2: 200
3: 783
4: 2563
Right 1177614665 21:23501182-23501204 TGATATGGGCAATGAAGTCCAGG 0: 17
1: 555
2: 1444
3: 1685
4: 1758
1177614660_1177614661 -8 Left 1177614660 21:23501141-23501163 CCTAGAGACTTGTTAAATTGTTG 0: 65
1: 93
2: 200
3: 783
4: 2563
Right 1177614661 21:23501156-23501178 AATTGTTGTGACCAAAATGCTGG No data
1177614660_1177614666 24 Left 1177614660 21:23501141-23501163 CCTAGAGACTTGTTAAATTGTTG 0: 65
1: 93
2: 200
3: 783
4: 2563
Right 1177614666 21:23501188-23501210 GGGCAATGAAGTCCAGGCTGAGG 0: 12
1: 519
2: 1319
3: 1710
4: 1681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177614660 Original CRISPR CAACAATTTAACAAGTCTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr