ID: 1177614664

View in Genome Browser
Species Human (GRCh38)
Location 21:23501168-23501190
Sequence CAAAATGCTGGTAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177614660_1177614664 4 Left 1177614660 21:23501141-23501163 CCTAGAGACTTGTTAAATTGTTG 0: 65
1: 93
2: 200
3: 783
4: 2563
Right 1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177614664 Original CRISPR CAAAATGCTGGTAGTGATAT GGG Intergenic
No off target data available for this crispr