ID: 1177617316

View in Genome Browser
Species Human (GRCh38)
Location 21:23539893-23539915
Sequence TCCCCTAGGCTAGCCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177617316_1177617319 3 Left 1177617316 21:23539893-23539915 CCACACTGGGCTAGCCTAGGGGA No data
Right 1177617319 21:23539919-23539941 ACAGCTGTCCCTGTATTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177617316 Original CRISPR TCCCCTAGGCTAGCCCAGTG TGG (reversed) Intergenic
No off target data available for this crispr