ID: 1177621988

View in Genome Browser
Species Human (GRCh38)
Location 21:23607913-23607935
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177621988_1177621990 -1 Left 1177621988 21:23607913-23607935 CCATCTGTGACTATCTTCTTGTC No data
Right 1177621990 21:23607935-23607957 CCTTTACCTCCCAAAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177621988 Original CRISPR GACAAGAAGATAGTCACAGA TGG (reversed) Intergenic
No off target data available for this crispr