ID: 1177622510

View in Genome Browser
Species Human (GRCh38)
Location 21:23614734-23614756
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177622505_1177622510 21 Left 1177622505 21:23614690-23614712 CCTGTTTTTCACATTTCATTTTA No data
Right 1177622510 21:23614734-23614756 TAGTAGGCTTATATGTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177622510 Original CRISPR TAGTAGGCTTATATGTTTAT GGG Intergenic
No off target data available for this crispr