ID: 1177626372

View in Genome Browser
Species Human (GRCh38)
Location 21:23665692-23665714
Sequence ATTCTGAGCCTGTCATATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 2, 2: 0, 3: 18, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177626372_1177626376 25 Left 1177626372 21:23665692-23665714 CCCATATATGACAGGCTCAGAAT 0: 1
1: 2
2: 0
3: 18
4: 132
Right 1177626376 21:23665740-23665762 GGAGAAAGTAACAGTAGCAATGG No data
1177626372_1177626374 4 Left 1177626372 21:23665692-23665714 CCCATATATGACAGGCTCAGAAT 0: 1
1: 2
2: 0
3: 18
4: 132
Right 1177626374 21:23665719-23665741 CATCCTATCTTTAGTAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177626372 Original CRISPR ATTCTGAGCCTGTCATATAT GGG (reversed) Intergenic