ID: 1177626372 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:23665692-23665714 |
| Sequence | ATTCTGAGCCTGTCATATAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 153 | |||
| Summary | {0: 1, 1: 2, 2: 0, 3: 18, 4: 132} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177626372_1177626376 | 25 | Left | 1177626372 | 21:23665692-23665714 | CCCATATATGACAGGCTCAGAAT | 0: 1 1: 2 2: 0 3: 18 4: 132 |
||
| Right | 1177626376 | 21:23665740-23665762 | GGAGAAAGTAACAGTAGCAATGG | No data | ||||
| 1177626372_1177626374 | 4 | Left | 1177626372 | 21:23665692-23665714 | CCCATATATGACAGGCTCAGAAT | 0: 1 1: 2 2: 0 3: 18 4: 132 |
||
| Right | 1177626374 | 21:23665719-23665741 | CATCCTATCTTTAGTAAGTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177626372 | Original CRISPR | ATTCTGAGCCTGTCATATAT GGG (reversed) | Intergenic | ||