ID: 1177626372 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:23665692-23665714 |
Sequence | ATTCTGAGCCTGTCATATAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1177626372_1177626374 | 4 | Left | 1177626372 | 21:23665692-23665714 | CCCATATATGACAGGCTCAGAAT | No data | ||
Right | 1177626374 | 21:23665719-23665741 | CATCCTATCTTTAGTAAGTTAGG | No data | ||||
1177626372_1177626376 | 25 | Left | 1177626372 | 21:23665692-23665714 | CCCATATATGACAGGCTCAGAAT | No data | ||
Right | 1177626376 | 21:23665740-23665762 | GGAGAAAGTAACAGTAGCAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1177626372 | Original CRISPR | ATTCTGAGCCTGTCATATAT GGG (reversed) | Intergenic | ||