ID: 1177626373 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:23665693-23665715 |
| Sequence | AATTCTGAGCCTGTCATATA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177626373_1177626376 | 24 | Left | 1177626373 | 21:23665693-23665715 | CCATATATGACAGGCTCAGAATT | No data | ||
| Right | 1177626376 | 21:23665740-23665762 | GGAGAAAGTAACAGTAGCAATGG | No data | ||||
| 1177626373_1177626374 | 3 | Left | 1177626373 | 21:23665693-23665715 | CCATATATGACAGGCTCAGAATT | No data | ||
| Right | 1177626374 | 21:23665719-23665741 | CATCCTATCTTTAGTAAGTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177626373 | Original CRISPR | AATTCTGAGCCTGTCATATA TGG (reversed) | Intergenic | ||